The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
RNA interference(RNAi)targeting lethal genes in insects has great potential for sustainable crop protection.Compared with traditional double-stranded(ds)RNA delivery systems,nanoparticles such as chitosan,liposomes,an...RNA interference(RNAi)targeting lethal genes in insects has great potential for sustainable crop protection.Compared with traditional double-stranded(ds)RNA delivery systems,nanoparticles such as chitosan,liposomes,and cationic dendrimers offer advantages in delivering dsRNA/small interfering(si)RNA to improve RNAi efficiency,thus promoting the development and practice of RNAi-based pest management strategies.Here,we illustrate the limitations of traditional dsRNA delivery systems,reveal the mechanism of nanoparticle-mediated RNAi,summarize the recent progress and successful applications of nanoparticle-mediated RNAi in pest management,and finally address the prospects of nanoparticle-based RNA pesticides.展开更多
In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
RNA interference(RNAi)has emerged as a powerful technology for pest management.Previously,we have shown that plastid-mediated RNAi(PM-RNAi)can be utilized to control the Colorado potato beetle,an insect pest in the Ch...RNA interference(RNAi)has emerged as a powerful technology for pest management.Previously,we have shown that plastid-mediated RNAi(PM-RNAi)can be utilized to control the Colorado potato beetle,an insect pest in the Chrysomelidae family;however,whether this technology is suitable for controlling pests in the Coccinellidae remained unknown.The coccinellid 28-spotted potato ladybird(Henosepilachna vigintioctopunctata;HV)is a serious pest of solanaceous crops.In this study,we identified three efficient target genes(β-Actin,SRP54,and SNAP)for RNAi using in vitro double-stranded RNAs(dsRNAs)fed to HV,and found that dsRNAs targetingβ-Actin messenger RNA(dsACT)induced more potent RNAi than those targeting the other two genes.We next generated transplastomic and nuclear transgenic potato(Solanum tuberosum)plants expressing HV dsACT.Long dsACT stably accumulated to up to 0.7%of the total cellular RNA in the transplastomic plants,at least three orders of magnitude higher than in the nuclear transgenic plants.Notably,the transplastomic plants also exhibited a significantly stronger resistance to HV,killing all larvae within 6 d.Our data demonstrate the potential of PM-RNAi as an efficient pest control measure for HV,extending the application range of this technology to Coccinellidae pests.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
基金the Beijing Natural Science Foundation(6204043)National Natural Science Foundation of China(31900363).
文摘RNA interference(RNAi)targeting lethal genes in insects has great potential for sustainable crop protection.Compared with traditional double-stranded(ds)RNA delivery systems,nanoparticles such as chitosan,liposomes,and cationic dendrimers offer advantages in delivering dsRNA/small interfering(si)RNA to improve RNAi efficiency,thus promoting the development and practice of RNAi-based pest management strategies.Here,we illustrate the limitations of traditional dsRNA delivery systems,reveal the mechanism of nanoparticle-mediated RNAi,summarize the recent progress and successful applications of nanoparticle-mediated RNAi in pest management,and finally address the prospects of nanoparticle-based RNA pesticides.
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
基金supported by grants from the Natural Science Foundation of Hubei Province(2020CFA012)the National Natural Science Foundation of China(32271912)to J.Z。
文摘RNA interference(RNAi)has emerged as a powerful technology for pest management.Previously,we have shown that plastid-mediated RNAi(PM-RNAi)can be utilized to control the Colorado potato beetle,an insect pest in the Chrysomelidae family;however,whether this technology is suitable for controlling pests in the Coccinellidae remained unknown.The coccinellid 28-spotted potato ladybird(Henosepilachna vigintioctopunctata;HV)is a serious pest of solanaceous crops.In this study,we identified three efficient target genes(β-Actin,SRP54,and SNAP)for RNAi using in vitro double-stranded RNAs(dsRNAs)fed to HV,and found that dsRNAs targetingβ-Actin messenger RNA(dsACT)induced more potent RNAi than those targeting the other two genes.We next generated transplastomic and nuclear transgenic potato(Solanum tuberosum)plants expressing HV dsACT.Long dsACT stably accumulated to up to 0.7%of the total cellular RNA in the transplastomic plants,at least three orders of magnitude higher than in the nuclear transgenic plants.Notably,the transplastomic plants also exhibited a significantly stronger resistance to HV,killing all larvae within 6 d.Our data demonstrate the potential of PM-RNAi as an efficient pest control measure for HV,extending the application range of this technology to Coccinellidae pests.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
