The monkeypox virus(MPXV)has triggered a current outbreak globally.Genome sequencing of MPXV and rapid tracing of genetic variants will benefit disease diagnosis and control.It is a significant challenge but necessary...The monkeypox virus(MPXV)has triggered a current outbreak globally.Genome sequencing of MPXV and rapid tracing of genetic variants will benefit disease diagnosis and control.It is a significant challenge but necessary to optimize the strategy and application of rapid full-length genome identification and to track variations of MPXV in clinical specimens with low viral loads,as it is one of the DNA viruses with the largest genome and the most AT-biased,and has a significant number of tandem repeats.Here we evaluated the performance of metagenomic and amplicon sequencing techniques,and three sequencing platforms in MPXV genome sequencing based on multiple clinical specimens of five mpox cases in Chinese mainland.We rapidly identified the full-length genome of MPXV with the assembly of accurate tandem repeats in multiple clinical specimens.Amplicon sequencing enables cost-effective and rapid sequencing of clinical specimens to obtain high-quality MPXV genomes.Third-generation sequencing facilitates the assembly of the terminal tandem repeat regions in the monkeypox virus genome and corrects a common misassembly in published sequences.Besides,several intra-host single nucleotide variations were identified in the first imported mpox case.This study offers an evaluation of various strategies aimed at identifying the complete genome of MPXV in clinical specimens.The findings of this study will significantly enhance the surveillance of MPXV.展开更多
Genome sequencing has shown strong capabilities in the initial stages of the COVID-19 pandemic such as pathogen identification and virus preliminary tracing.While the rapid acquisition of SARS-Co V-2 genome from clini...Genome sequencing has shown strong capabilities in the initial stages of the COVID-19 pandemic such as pathogen identification and virus preliminary tracing.While the rapid acquisition of SARS-Co V-2 genome from clinical specimens is limited by their low nucleic acid load and the complexity of the nucleic acid background.To address this issue,we modified and evaluated an approach by utilizing SARS-Co V-2-specific amplicon amplification and Oxford Nanopore Prometh ION platform.This workflow started with the throat swab of the COVID-19 patient,combined reverse transcript PCR,and multi-amplification in one-step to shorten the experiment time,then can quickly and steadily obtain high-quality SARS-Co V-2 genome within 24 h.A comprehensive evaluation of the method was conducted in 42 samples:the sequencing quality of the method was correlated well with the viral load of the samples;high-quality SARS-Co V-2 genome could be obtained stably in the samples with Ct value up to 39.14;data yielding for different Ct values were assessed and the recommended sequencing time was 8 h for samples with Ct value of less than 20;variation analysis indicated that the method can detect the existing and emerging genomic mutations as well;Illumina sequencing verified that ultra-deep sequencing can greatly improve the single read error rate of Nanopore sequencing,making it as low as 0.4/10,000 bp.In summary,high-quality SARS-Co V-2 genome can be acquired by utilizing the amplicon amplification and it is an effective method in accelerating the acquisition of genetic resources and tracking the genome diversity of SARSCo V-2.展开更多
Objective Viral encephalitis is an infectious disease severely affecting human health.It is caused by a wide variety of viral pathogens,including herpes viruses,flaviviruses,enteroviruses,and other viruses.The laborat...Objective Viral encephalitis is an infectious disease severely affecting human health.It is caused by a wide variety of viral pathogens,including herpes viruses,flaviviruses,enteroviruses,and other viruses.The laboratory diagnosis of viral encephalitis is a worldwide challenge.Recently,high-throughput sequencing technology has provided new tools for diagnosing central nervous system infections.Thus,In this study,we established a multipathogen detection platform for viral encephalitis based on amplicon sequencing.Methods We designed nine pairs of specific polymerase chain reaction(PCR)primers for the 12 viruses by reviewing the relevant literature.The detection ability of the primers was verified by software simulation and the detection of known positive samples.Amplicon sequencing was used to validate the samples,and consistency was compared with Sanger sequencing.Results The results showed that the target sequences of various pathogens were obtained at a coverage depth level greater than 20×,and the sequence lengths were consistent with the sizes of the predicted amplicons.The sequences were verified using the National Center for Biotechnology Information BLAST,and all results were consistent with the results of Sanger sequencing.Conclusion Amplicon-based high-throughput sequencing technology is feasible as a supplementary method for the pathogenic detection of viral encephalitis.It is also a useful tool for the high-volume screening of clinical samples.展开更多
Dicyemids(phylum Dicyemida),primarily found in the renal organs of coleoid cephalopods,are a unique group of morphologically simple parasites with global distribution.Here,we investigated the diversity and prevalence ...Dicyemids(phylum Dicyemida),primarily found in the renal organs of coleoid cephalopods,are a unique group of morphologically simple parasites with global distribution.Here,we investigated the diversity and prevalence of dicyemid communities in a wide range of cephalopod hosts across four geographic zones(the North East Atlantic,Mediterranean Sea,China Sea in the Western North Pacific,and Australia in the South Pacific)using Illumina sequencing of the 18S rDNA amplicons.Across 227 host samples,we identified 482 amplicon sequence variants,which clustered into 95 genetic types.The results indicated a higher number of distinct genetic types within Dicyemida than those currently identified through morphology-based taxonomy.Our finding of 46 dicyemid types in the common cuttlefish(Sepia officinalis)contrasts sharply with the previous records of a maximum of four species in this host.Furthermore,only a few host species exhibited a single dicyemid type,while most harbored multiple types;several types were distributed worldwide.Additionally,we identified eight new cephalopod hosts in the Pacific.Analyses of community(α)diversity suggested the unique character of certain geographical areas,such as the Bass Strait(Australia).β-diversity analyses confirmed that geographic location and host species were significant determinants of the dicyemid community composition.These results suggest that current species classifications may underestimate the true diversity of dicyemids.They emphasize the intricate interplay between geography,host specificity,and dicyemid community diversity.展开更多
Fish, which are vital for both aquatic ecosystem functionality and global food supply, rely heavily on theirgastrointestinal tract (GIT) microbiota for the digestion that underpins their growth and health. Takifugu pu...Fish, which are vital for both aquatic ecosystem functionality and global food supply, rely heavily on theirgastrointestinal tract (GIT) microbiota for the digestion that underpins their growth and health. Takifugu puf-ferfish, which are an example of species evolved through adaptive radiation, possess a GIT that is specialized forantipredator defense and gluttonous feeding behaviors, offering a unique model to explore the effects of GrTcompartmentalization and host genetics on gut microbial communities. Here we compiled 78 full and partial-length 16 S rRNA amplicon datasets across three anteroposteriorly distinct intestinal sites in a cohort of cohab-itating artificial hybrid and purebred Takifugu pufferfishes. Our findings reveal a compositional and functionalbiogeography of pufferfish gut microbiota along the GIT and between host genetics. Additionally, the differentialabundance of specific amplicon sequence variants and their correlation with host genetic backgrounds and in-testinal sections highlight the role of environmental filtering in shaping microbial communities,with certainbacterial taxa exhibiting strong preferences for particular intestinal sites or genetic backgrounds,suggestingpotential localized adaptation or functional specialization. This study enhances our understanding of the intricateinterplay between host genetics, gut anatomy, and microbiota in fish, underscoring the importance of detailedmicrobial profiling in conservation efforts and aquaculture practices, and emphasizing the necessity of integratingfull-length 16 S rRNA sequencing with partial-length datasets to comprehensively understand microbial diversityand function, paving the way for improved fish health management and sustainable aquaculture strategies.展开更多
A novel packaging system for producing recombinant adeno-associated virus (rAAV) vector was described. Instead of the conventional method for rAAV production by two-plasmid co-transfection followed by superinfec-tion ...A novel packaging system for producing recombinant adeno-associated virus (rAAV) vector was described. Instead of the conventional method for rAAV production by two-plasmid co-transfection followed by superinfec-tion with adenovirus 5, an HSV-1 amplicon system expressing AAV-2 rep and cap genes from their native promoters was used to provide complete helper functions for rAAV replicating and packaging. This HSV-1 amplicon stock consisted of two kinds of infectious HSV-1 virions, a replicating-defective HSV-1 amplicon pseudovirus harboring multi-copies of AAV-2 rep and cap gene and a temperature-sensitive HSV-1 mutant strain ts-KOS. High-liter rAAV was generated with this new packaging system. This packaging system gives a simple and scaleable process for rAAV production.展开更多
Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as micr...Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.展开更多
The microbiome associated with brown planthopper(BPH)plays an important role in mediating host health and fitness.Characterization of the microbial community and its structure is prerequisite for understanding the int...The microbiome associated with brown planthopper(BPH)plays an important role in mediating host health and fitness.Characterization of the microbial community and its structure is prerequisite for understanding the intricate symbiotic relationships between microbes and host insect.Here,we investigated the bacterial and fungal communities of BPH at different developmental stages using high-throughput amplicon sequencing.Our results revealed that both the bacterial and fungal communities were diverse and dynamic during BPH development.The bacterial communities were generally richer than fungi in each developmental stage.At 97%similarly,19 phyla and 278 genera of bacteria were an-notated,while five fungal phyla comprising 80 genera were assigned.The highest species richness for the bacterial communities was detected in the nymphal stage.The taxonomic diversity of the fungal communities in female adults was generally at a relatively higher level when compared to other developmental stages.The most dominant phylum of bacteria and fungi at each developmental stage all belonged to Proteobacteria and Ascomycota,re-spectively.A significantly lower abundance of bacterial genus Acinetobacter was recorded in the egg stage when compared to other developmental stages,while the dominant fun-gal genus Wallemia was more abundant in the nymph and adult stages than in the egg stage.Additionally,the microbial composition differed between male and female adults,suggesting that the microbial communties In BPH were gender-dependent.Uverall,our study enriches our knowledge on the microbial communities associated with BPH and will provide clues to develop potential biocontrol techniques against this rice pest.展开更多
High-throughput sequencing of amplicons has been widely used to precisely and efficiently identify species compositions and analyze community structures,greatly promoting biological studies involving large amounts of ...High-throughput sequencing of amplicons has been widely used to precisely and efficiently identify species compositions and analyze community structures,greatly promoting biological studies involving large amounts of complex samples,especially those involving environmental and pathogen-monitoring ones.Commercial library preparation kits for amplicon sequencing,which generally require multiple steps,including adapter ligation and indexing,are expensive and time-consuming,especially for applications at a large scale.To overcome these limitations,a“one-step PCR approach”has been previously proposed for constructions of amplicon libraries using long fusion primers.However,efficient amplifications of target genes and accurate demultiplexing of pooled sequencing data remain to be addressed.To tackle these,we present an integrative protocol for one-step PCR amplicon library construction(OSPALC).High-quality reads have been generated by this approach to reliably identify species compositions of mock bacterial communities and environmental samples.With this protocol,the amplicon library is constructed through one regular PCR with long primers,and the total cost per DNA/cDNA sample decreases to just 7%of the typical cost via the multi-step PCR approach.Empirically tested primers and optimized PCR conditions to construct OSPALC libraries for 16S rDNA V4 regions are demonstrated as a case study.Tools to design primers targeting at any genomic regions are also presented.In principle,OSPALC can be readily applied to construct amplicon libraries of any target genes using DNA or RNA samples,and will facilitate research in numerous fields.展开更多
Wet-salted skin,as a special artificial high-salt environment,is rich in protein,fat,collagen and other nutrient substrates,and is a rich resource of halotolerant and halophilic microorganisms.However,knowledge gaps r...Wet-salted skin,as a special artificial high-salt environment,is rich in protein,fat,collagen and other nutrient substrates,and is a rich resource of halotolerant and halophilic microorganisms.However,knowledge gaps regarding the microbial community structure and inter taxa associations of wet-salted skin are large.In this study,the spatiotemporal dynamics and community structure of microorganisms present on wet-salted goatskins were investigated using 16S rRNA gene amplicon sequencing and culturable technique.Alpha diversity analysis based on Sobs,Chao,Ace and Shannon indices revealed that microbial diversity on the wet-salted goatskins exhibited a trend of‘down→up→down→flat’with time.During preservation,genera belonging to the bacteria domain such as Aci-netobacter,Weissella and Streptococcus were slowly dying out,whereas those belonging to halophilic archaea such as Natrialba and Haloterrigena were gradually flourishing.Moreover,to resist high-salt stress,microorganisms on the wet-salted goatskin gradually migrated from the outside to the inside,eventually leading to the microbial diversity inside the skin being the same as or even higher than that on the skin surface.Venn diagram analysis revealed that the strains of some genera,including Psychrobacter,Salimicrobium,Salinicola,Ornithinibacillus,Halomonas,Bacillus and Chromohalobacter,were distributed throughout the interior and exterior of the wet-salted goatskin and existed during various periods.Accordingly,45 protease-producing halophilic or halotolerant microorganisms were isolated and screened from the wet-salted goatskin using the gradient dilution plate method.Importantly,16S rRNA genes of some bacteria exhibited less than 99.5%similarity to valid published species,indicating that they likely are novel spe-cies and have a good potential for application.展开更多
Dialeurolonga malleswaramensis Sundararaj （Hemiptera： Aleyrodidae） is a phytophagous sap sucking insect. It infests Polyalthia longifolia, an important avenue tree of India, effective in alleviating noise pollution...Dialeurolonga malleswaramensis Sundararaj （Hemiptera： Aleyrodidae） is a phytophagous sap sucking insect. It infests Polyalthia longifolia, an important avenue tree of India, effective in alleviating noise pollution and having immense medicinal importance. Samples of this insect were collected from Polyalthia longifolia. The cytochrome c oxidase subunit I gene （mtCOl） helped in the molecular characterization of the insect. This study reports the bacterial diversity in D. malleswararnensis adults by high throughput 16S rDNA amplicon pyrosequencing. The major genera identified were Portiera and Arsenophonus. Other bacterial genera detected were uncultured alpha proteobacterium, Sphingopyxis and Methylobacterium. We also employed fluorescence in situ hybridization （FISH） in whole mount samples to confirm the presence of dominant endosymbionts Portiera and Arsenophonus to the bacteriocyte of D. malleswaramensis. This study concludes that combining techniques like 16S rDNA amplicon pyrosequencing and FISH reveal both dominant and rare bacteria. The data also predict the evolutionary position of this pest with respect to other whitefly species using a mitochondrial marker.展开更多
基金supported by the National Key Research and Development Program of China(2022YFC2303401,2022YFC2304100,2016YFD0500301,2021YFC0863300)the Beijing Science and Technology Plan(Z211100002521017)the National Natural Science Foundation of China(82241080)。
文摘The monkeypox virus(MPXV)has triggered a current outbreak globally.Genome sequencing of MPXV and rapid tracing of genetic variants will benefit disease diagnosis and control.It is a significant challenge but necessary to optimize the strategy and application of rapid full-length genome identification and to track variations of MPXV in clinical specimens with low viral loads,as it is one of the DNA viruses with the largest genome and the most AT-biased,and has a significant number of tandem repeats.Here we evaluated the performance of metagenomic and amplicon sequencing techniques,and three sequencing platforms in MPXV genome sequencing based on multiple clinical specimens of five mpox cases in Chinese mainland.We rapidly identified the full-length genome of MPXV with the assembly of accurate tandem repeats in multiple clinical specimens.Amplicon sequencing enables cost-effective and rapid sequencing of clinical specimens to obtain high-quality MPXV genomes.Third-generation sequencing facilitates the assembly of the terminal tandem repeat regions in the monkeypox virus genome and corrects a common misassembly in published sequences.Besides,several intra-host single nucleotide variations were identified in the first imported mpox case.This study offers an evaluation of various strategies aimed at identifying the complete genome of MPXV in clinical specimens.The findings of this study will significantly enhance the surveillance of MPXV.
基金supported by grants from the Foundation for National Mega Project on Major Infectious Disease Prevention(grant number 2017ZX10103005-005)National Key Research and Development Program of China(2020YFC0845800 and 2020YFC0845600)the National Natural Science Foundation of China(31970548 and 91631110)。
文摘Genome sequencing has shown strong capabilities in the initial stages of the COVID-19 pandemic such as pathogen identification and virus preliminary tracing.While the rapid acquisition of SARS-Co V-2 genome from clinical specimens is limited by their low nucleic acid load and the complexity of the nucleic acid background.To address this issue,we modified and evaluated an approach by utilizing SARS-Co V-2-specific amplicon amplification and Oxford Nanopore Prometh ION platform.This workflow started with the throat swab of the COVID-19 patient,combined reverse transcript PCR,and multi-amplification in one-step to shorten the experiment time,then can quickly and steadily obtain high-quality SARS-Co V-2 genome within 24 h.A comprehensive evaluation of the method was conducted in 42 samples:the sequencing quality of the method was correlated well with the viral load of the samples;high-quality SARS-Co V-2 genome could be obtained stably in the samples with Ct value up to 39.14;data yielding for different Ct values were assessed and the recommended sequencing time was 8 h for samples with Ct value of less than 20;variation analysis indicated that the method can detect the existing and emerging genomic mutations as well;Illumina sequencing verified that ultra-deep sequencing can greatly improve the single read error rate of Nanopore sequencing,making it as low as 0.4/10,000 bp.In summary,high-quality SARS-Co V-2 genome can be acquired by utilizing the amplicon amplification and it is an effective method in accelerating the acquisition of genetic resources and tracking the genome diversity of SARSCo V-2.
基金supported by the National Key Research and Development Program(grant number:2022YFC2305304).
文摘Objective Viral encephalitis is an infectious disease severely affecting human health.It is caused by a wide variety of viral pathogens,including herpes viruses,flaviviruses,enteroviruses,and other viruses.The laboratory diagnosis of viral encephalitis is a worldwide challenge.Recently,high-throughput sequencing technology has provided new tools for diagnosing central nervous system infections.Thus,In this study,we established a multipathogen detection platform for viral encephalitis based on amplicon sequencing.Methods We designed nine pairs of specific polymerase chain reaction(PCR)primers for the 12 viruses by reviewing the relevant literature.The detection ability of the primers was verified by software simulation and the detection of known positive samples.Amplicon sequencing was used to validate the samples,and consistency was compared with Sanger sequencing.Results The results showed that the target sequences of various pathogens were obtained at a coverage depth level greater than 20×,and the sequence lengths were consistent with the sizes of the predicted amplicons.The sequences were verified using the National Center for Biotechnology Information BLAST,and all results were consistent with the results of Sanger sequencing.Conclusion Amplicon-based high-throughput sequencing technology is feasible as a supplementary method for the pathogenic detection of viral encephalitis.It is also a useful tool for the high-volume screening of clinical samples.
基金Computational resources were provided by the e-INFRA CZ project(ID:90254),supported by the Ministry of Education,Youth and Sports of the Czech Republicfunded by the Czech Science Agency(Project No.19-28399X).
文摘Dicyemids(phylum Dicyemida),primarily found in the renal organs of coleoid cephalopods,are a unique group of morphologically simple parasites with global distribution.Here,we investigated the diversity and prevalence of dicyemid communities in a wide range of cephalopod hosts across four geographic zones(the North East Atlantic,Mediterranean Sea,China Sea in the Western North Pacific,and Australia in the South Pacific)using Illumina sequencing of the 18S rDNA amplicons.Across 227 host samples,we identified 482 amplicon sequence variants,which clustered into 95 genetic types.The results indicated a higher number of distinct genetic types within Dicyemida than those currently identified through morphology-based taxonomy.Our finding of 46 dicyemid types in the common cuttlefish(Sepia officinalis)contrasts sharply with the previous records of a maximum of four species in this host.Furthermore,only a few host species exhibited a single dicyemid type,while most harbored multiple types;several types were distributed worldwide.Additionally,we identified eight new cephalopod hosts in the Pacific.Analyses of community(α)diversity suggested the unique character of certain geographical areas,such as the Bass Strait(Australia).β-diversity analyses confirmed that geographic location and host species were significant determinants of the dicyemid community composition.These results suggest that current species classifications may underestimate the true diversity of dicyemids.They emphasize the intricate interplay between geography,host specificity,and dicyemid community diversity.
基金supported by the National Natural Science Foundation of China(42376119 to X.J.)the Project for Seed Industry Vitalization of Jiangsu Province(JBGS[2021]133 to Z.Z.)the Natural Science Foundation of Jiangsu Province(BK20210362 to X.J.).
文摘Fish, which are vital for both aquatic ecosystem functionality and global food supply, rely heavily on theirgastrointestinal tract (GIT) microbiota for the digestion that underpins their growth and health. Takifugu puf-ferfish, which are an example of species evolved through adaptive radiation, possess a GIT that is specialized forantipredator defense and gluttonous feeding behaviors, offering a unique model to explore the effects of GrTcompartmentalization and host genetics on gut microbial communities. Here we compiled 78 full and partial-length 16 S rRNA amplicon datasets across three anteroposteriorly distinct intestinal sites in a cohort of cohab-itating artificial hybrid and purebred Takifugu pufferfishes. Our findings reveal a compositional and functionalbiogeography of pufferfish gut microbiota along the GIT and between host genetics. Additionally, the differentialabundance of specific amplicon sequence variants and their correlation with host genetic backgrounds and in-testinal sections highlight the role of environmental filtering in shaping microbial communities,with certainbacterial taxa exhibiting strong preferences for particular intestinal sites or genetic backgrounds,suggestingpotential localized adaptation or functional specialization. This study enhances our understanding of the intricateinterplay between host genetics, gut anatomy, and microbiota in fish, underscoring the importance of detailedmicrobial profiling in conservation efforts and aquaculture practices, and emphasizing the necessity of integratingfull-length 16 S rRNA sequencing with partial-length datasets to comprehensively understand microbial diversityand function, paving the way for improved fish health management and sustainable aquaculture strategies.
基金Project supported by the National High Technology Development Program National Climbing Project
文摘A novel packaging system for producing recombinant adeno-associated virus (rAAV) vector was described. Instead of the conventional method for rAAV production by two-plasmid co-transfection followed by superinfec-tion with adenovirus 5, an HSV-1 amplicon system expressing AAV-2 rep and cap genes from their native promoters was used to provide complete helper functions for rAAV replicating and packaging. This HSV-1 amplicon stock consisted of two kinds of infectious HSV-1 virions, a replicating-defective HSV-1 amplicon pseudovirus harboring multi-copies of AAV-2 rep and cap gene and a temperature-sensitive HSV-1 mutant strain ts-KOS. High-liter rAAV was generated with this new packaging system. This packaging system gives a simple and scaleable process for rAAV production.
文摘Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
基金This work was.financially supported by the Na-tional Natural Science Foundation of China(Grant No.31601698)the Natural Science Foundation of Zhejiang Province(Grant No.LR 19C140001)+1 种基金the Young Elite Scientist Sponsorship Program by CAST(Grant No.2016QNRC001)the Key Research and Development Program of Zhejiang Province(Grant No.2019C02015).
文摘The microbiome associated with brown planthopper(BPH)plays an important role in mediating host health and fitness.Characterization of the microbial community and its structure is prerequisite for understanding the intricate symbiotic relationships between microbes and host insect.Here,we investigated the bacterial and fungal communities of BPH at different developmental stages using high-throughput amplicon sequencing.Our results revealed that both the bacterial and fungal communities were diverse and dynamic during BPH development.The bacterial communities were generally richer than fungi in each developmental stage.At 97%similarly,19 phyla and 278 genera of bacteria were an-notated,while five fungal phyla comprising 80 genera were assigned.The highest species richness for the bacterial communities was detected in the nymphal stage.The taxonomic diversity of the fungal communities in female adults was generally at a relatively higher level when compared to other developmental stages.The most dominant phylum of bacteria and fungi at each developmental stage all belonged to Proteobacteria and Ascomycota,re-spectively.A significantly lower abundance of bacterial genus Acinetobacter was recorded in the egg stage when compared to other developmental stages,while the dominant fun-gal genus Wallemia was more abundant in the nymph and adult stages than in the egg stage.Additionally,the microbial composition differed between male and female adults,suggesting that the microbial communties In BPH were gender-dependent.Uverall,our study enriches our knowledge on the microbial communities associated with BPH and will provide clues to develop potential biocontrol techniques against this rice pest.
基金supported by the National Natural Science Foundation of China(31961123002,31872228)the Fundamental Research Funds for the Central Universities of China(202041001)+1 种基金the Young Taishan Scholars Program of Shandong Province(tsqn201812024)the National Science Foundation(DEB-1927159).
文摘High-throughput sequencing of amplicons has been widely used to precisely and efficiently identify species compositions and analyze community structures,greatly promoting biological studies involving large amounts of complex samples,especially those involving environmental and pathogen-monitoring ones.Commercial library preparation kits for amplicon sequencing,which generally require multiple steps,including adapter ligation and indexing,are expensive and time-consuming,especially for applications at a large scale.To overcome these limitations,a“one-step PCR approach”has been previously proposed for constructions of amplicon libraries using long fusion primers.However,efficient amplifications of target genes and accurate demultiplexing of pooled sequencing data remain to be addressed.To tackle these,we present an integrative protocol for one-step PCR amplicon library construction(OSPALC).High-quality reads have been generated by this approach to reliably identify species compositions of mock bacterial communities and environmental samples.With this protocol,the amplicon library is constructed through one regular PCR with long primers,and the total cost per DNA/cDNA sample decreases to just 7%of the typical cost via the multi-step PCR approach.Empirically tested primers and optimized PCR conditions to construct OSPALC libraries for 16S rDNA V4 regions are demonstrated as a case study.Tools to design primers targeting at any genomic regions are also presented.In principle,OSPALC can be readily applied to construct amplicon libraries of any target genes using DNA or RNA samples,and will facilitate research in numerous fields.
基金National Key Research and Development Program of China(2017YFB0308401).
文摘Wet-salted skin,as a special artificial high-salt environment,is rich in protein,fat,collagen and other nutrient substrates,and is a rich resource of halotolerant and halophilic microorganisms.However,knowledge gaps regarding the microbial community structure and inter taxa associations of wet-salted skin are large.In this study,the spatiotemporal dynamics and community structure of microorganisms present on wet-salted goatskins were investigated using 16S rRNA gene amplicon sequencing and culturable technique.Alpha diversity analysis based on Sobs,Chao,Ace and Shannon indices revealed that microbial diversity on the wet-salted goatskins exhibited a trend of‘down→up→down→flat’with time.During preservation,genera belonging to the bacteria domain such as Aci-netobacter,Weissella and Streptococcus were slowly dying out,whereas those belonging to halophilic archaea such as Natrialba and Haloterrigena were gradually flourishing.Moreover,to resist high-salt stress,microorganisms on the wet-salted goatskin gradually migrated from the outside to the inside,eventually leading to the microbial diversity inside the skin being the same as or even higher than that on the skin surface.Venn diagram analysis revealed that the strains of some genera,including Psychrobacter,Salimicrobium,Salinicola,Ornithinibacillus,Halomonas,Bacillus and Chromohalobacter,were distributed throughout the interior and exterior of the wet-salted goatskin and existed during various periods.Accordingly,45 protease-producing halophilic or halotolerant microorganisms were isolated and screened from the wet-salted goatskin using the gradient dilution plate method.Importantly,16S rRNA genes of some bacteria exhibited less than 99.5%similarity to valid published species,indicating that they likely are novel spe-cies and have a good potential for application.
文摘Dialeurolonga malleswaramensis Sundararaj （Hemiptera： Aleyrodidae） is a phytophagous sap sucking insect. It infests Polyalthia longifolia, an important avenue tree of India, effective in alleviating noise pollution and having immense medicinal importance. Samples of this insect were collected from Polyalthia longifolia. The cytochrome c oxidase subunit I gene （mtCOl） helped in the molecular characterization of the insect. This study reports the bacterial diversity in D. malleswararnensis adults by high throughput 16S rDNA amplicon pyrosequencing. The major genera identified were Portiera and Arsenophonus. Other bacterial genera detected were uncultured alpha proteobacterium, Sphingopyxis and Methylobacterium. We also employed fluorescence in situ hybridization （FISH） in whole mount samples to confirm the presence of dominant endosymbionts Portiera and Arsenophonus to the bacteriocyte of D. malleswaramensis. This study concludes that combining techniques like 16S rDNA amplicon pyrosequencing and FISH reveal both dominant and rare bacteria. The data also predict the evolutionary position of this pest with respect to other whitefly species using a mitochondrial marker.
