Myostatin(MSTN)is principally expressed in skeletal muscle and negatively regulates muscle growth and development.MSTN mutation can induce muscle overgrowth in cattle by activating cell proliferation,presenting a“dou...Myostatin(MSTN)is principally expressed in skeletal muscle and negatively regulates muscle growth and development.MSTN mutation can induce muscle overgrowth in cattle by activating cell proliferation,presenting a“double-muscle”phenotype.However,the specific regulatory mechanism is still unclear.Here,we found that Ca^(2+)content in muscle tissue and muscle satellite cells of MSTN mutated(MSTN^(–/–))cattle were significantly increased compared to wild-type(WT).Furthermore,transcriptome analysis of muscle satellite cells revealed that TRPC4 was significantly increased in MSTN^(–/–)cattle.And the expression of TRPC4 in muscle tissue of MSTN^(–/–)cattle was detected by RT-qPCR and Western blot,which was significantly higher than that of WT.These results suggested that MSTN mutation promoted muscle satellite cells proliferation through activation of TRPC4 channel.To further verify,ML204,a specific inhibitor of TRPC4,was used to treat MSTN^(–/–)muscle satellite cells.We found that cell proliferation was inhibited,calcineurin expression was downregulated,and the entry of NFATc3 into nuclei was reduced,which was similar to WT group.Thus,MSTN mutation leads to the activation of TRPC4 channel,which increases intracellular Ca^(2+)content,further activates calcineurin/NFATc3 pathway,and ultimately promotes the proliferation of muscle satellite cells.展开更多
Environmental DNA(eDNA)technology has revolutionized biodiversity monitoring with its non-invasive,sensitive,and cost-efficient approach.This paper systematically reviews eDNA advancements,examining its applications i...Environmental DNA(eDNA)technology has revolutionized biodiversity monitoring with its non-invasive,sensitive,and cost-efficient approach.This paper systematically reviews eDNA advancements,examining its applications in aquatic and terrestrial ecosystems and assessing China’s standardization progress.It delineates four developmental phases from single-species detection to high-throughput sequencing,and highlights China’s contribution to the development of technical standards.While significant progress has been made,challenges persist in quantitative accuracy,methodological consistency,and large-scale implementation.Future efforts should prioritize enhanced standardization,improved quantification techniques,broader applications,and international collaboration to drive innovation in eDNA technology.展开更多
Somatic variants in the cancer genome influence gene expression through diverse mechanisms depending on their specific locations.However,a systematic evaluation of the effects of somatic variants located in 3'untr...Somatic variants in the cancer genome influence gene expression through diverse mechanisms depending on their specific locations.However,a systematic evaluation of the effects of somatic variants located in 3'untranslated regions(3'UTRs)on alternative polyadenylation(APA)of m RNA remains lacking.In this study,we analyze 10,199 tumor samples across 32 cancer types and identify 1333 somatic single nucleotide variants(SNVs)associated with abnormal 3'UTR APA.Mechanistically,these 3'UTR SNVs can alter cisregulatory elements,such as the poly(A)signal and UGUA motif,leading to changes in APA.Minigene assays confirm that 3'UTR SNVs in multiple genes,including RPS23 and CHTOP,induce aberrant APA.Among affected genes,62 exhibit differential stability between tandem 3'UTR isoforms,including HSPA4and UCK2,validated by experimental assays.Finally,we establish that SNV-related abnormal APA usage serves as an additional layer of expression regulation for tumor-suppressor gene HMGN2 in breast cancer.Collectively,this study reveals 3'UTR APA as a critical mechanism mediating the functional impact of somatic noncoding variants in human cancers.展开更多
This study establishes and validates a method for the precise quantification of aquatic microbial loads using microbial diversity absolute quantitative sequencing.By adding synthetic spike-in DNA to water samples from...This study establishes and validates a method for the precise quantification of aquatic microbial loads using microbial diversity absolute quantitative sequencing.By adding synthetic spike-in DNA to water samples from the Dahei River prior to DNA extraction and 16S rRNA gene sequencing,it generates standard curves to convert sequencing data into absolute microbial copy numbers.The method,which is proved highly accurate(R^(2)>0.99),reveals a clear contrast between the river sites:the upstream community has not only a significantly higher total microbial load but also a completely different makeup of species compared to the downstream site.This approach effectively overcomes the limitations of relative abundance analysis,providing a powerful tool for environmental monitoring,and proposes key steps for future standardization to ensure data comparability and integration.展开更多
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the o...The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.展开更多
This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat(CRISPR)/Cas9-mediated gene knock-ins with zinc finger nucleases(ZFNs) and transcription activator-like effe...This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat(CRISPR)/Cas9-mediated gene knock-ins with zinc finger nucleases(ZFNs) and transcription activator-like effector nucleases(TALENs) in bovine and dairy goat fetal fibroblasts. To test the knock-in efficiency, a set of ZFNs and CRISPR/Cas9 plasmids were designed to edit the bovine myostatin(MSTN) gene at exon 2, while a set of TALENs and CRISPR/Cas9 plasmids were designed for editing the dairy goat β-casein gene at exon 2. Donor plasmids utilizing the ZFNs, TALENs, and CRISPR/Cas9 cutting sites were constructed in theGFP-PGK-Neo R plasmid background, including a 5′ and 3′ homologous arm flanking the genes humanized Fat-1(h Fat-1) or enhanced green fluorescent protein(eGFP). Subsequently, the ZFNs, TALENs, or CRISPR/Cas9 and thehFat-1 or eGFP plasmids were co-transfected by electroporation into bovine and dairy goat fetal fibroblasts. After G418(Geneticin) selection, single cells were obtained by mouth pipetting, flow cytometry or a cell shove. The gene knock-in events were screened by PCR across the homologous arms. The results showed that in bovine fetal fibrobalsts, the efficiencies of ZFNs-mediated eGFP andhFat-1 gene knock-ins were 13.68 and 0%, respectively. The efficiencies of CRISPR/Cas9-mediated eGFP andhFat-1 gene knock-ins were 77.02 and 79.01%, respectively. The eGFP gene knock-in efficiency using CRISPR/Cas9 was about 5.6 times higher than when using the ZFNs gene editing system. Additionally, thehFat-1 gene knock-in was only obtained when using the CRISPR/Cas9 system. The difference of knockin efficiencies between the ZFNs and CRISPR/Cas9 systems were extremely significant(P〈0.01). In the dairy goat fetal fibroblasts, the efficiencies of TALENs-mediated eGFP andhFat-1 gene knock-ins were 32.35 and 26.47%, respectively. Theefficiencies of eGFP and hFat-1 gene knock-ins using CRISPR/Cas9 were 70.37 and 74.29%, respectively. The knock-in efficiencies difference between the TALENs and CRISPR/Cas9 systems were extremely significant(P〈0.01). This study demonstrated that CRISPR/Cas9 was more efficient at gene knock-ins in domesticated animal cells than ZFNs and TALENs. The CRISPR/Cas9 technology offers a new era of precise gene editing in domesticated animal cell lines.展开更多
Lysophosphatidic acid(LPA)is a small molecule glycerophospholipid,which regulates multiple downstream signalling pathways through G-protein-coupled receptors to achieve numerous functions on oocyte maturation and embr...Lysophosphatidic acid(LPA)is a small molecule glycerophospholipid,which regulates multiple downstream signalling pathways through G-protein-coupled receptors to achieve numerous functions on oocyte maturation and embryo development.In this study,sheep in vitro fertilized embryos were applied to investigate the effects of LPA on early embryos development and embryonic stem cell establishment.At first,the maturation medium containing estrus female sheep serum and synthetic oviduct fluid(SOF)were optimized for sheep IVF,and then the effects of LPA were investigated.From 0.1 to 10μmol L^(–1),LPA had no significant effect on the cleavage rate(P>0.05),but the maturation rate and blastocyst rate increased dependently with LPA concentration(P<0.05),and the blastocyst morphology was normal.When the LPA concentration was 15μmol L^(–1),the maturation rate,cleavage rate and blastocyst rate decreased significantly(P<0.05),and the blastocyst exhibited abnormal morphology and could not develop into highquality blastocyst.Besides,the exogenous LPA increases the expression of LPAR2,LPAR4,TE-related gene CDX-2and pluripotency-related gene OCT-4 in sheep early IVF embryos with the raise of LPA concentration from 0.1 to 10μmol L^(–1).The expression of LPAR2,LPAR4,CDX-2 and OCT-4 from the LPA-0.1μmol L^(–1)to LPA-10μmol L^(–1)groups in early embryos were extremely significant(P<0.05),while the expression of these genes significantly decreased in 15μmol L^(–1)LPA-treated embryos compared with LPA-10μmol L^(–1)group(P<0.05).The inner cell mass in 15μmol L^(–1)LPA-treated embryos was also disturbed,and the blastocysts formation was abnormal.Secondly,the sheep IVF blastocysts were applied to establish embryonic stem cells.The results showed that LPA made the blastocyst inoculated cells grow towards TSC-like cells.They enhanced the fluorescence intensity and mRNA abundance of OCT-4 and CDX-2 as the concentration increased from 0 to 10μmol L^(–1),while 15μmol L^(–1)LPA decreased OCT-4 and CDX-2 expression in the derived cells.The expression of CDX-2 and OCT-4 in the blastocyst inoculated cells of LPA-1μmol L^(–1)group and LPA-10μmol L^(–1)group extremely significantly increased(P<0.05),but there was significant decrease in LPA-15μmol L^(–1)group compared with LPA-10μmol L^(–1)group(P<0.05).Meanwhile,the protein expression of LPAR2 and LPAR4 remarkably increased after treatment of LPA at 10μmol L^(–1)concentration.This study references the IVF embryo production and embryonic stem cell research of domestic animals.展开更多
Somatic cell nuclear transfer(SCNT)has been successfully employed across various mammalian species,yet cloned animals consistently exhibit low pregnancy rates,primarily due to placental abnormalities such as hyperplas...Somatic cell nuclear transfer(SCNT)has been successfully employed across various mammalian species,yet cloned animals consistently exhibit low pregnancy rates,primarily due to placental abnormalities such as hyperplasia and hypertrophy.This study investigated the involvement of the Hippo signaling pathway in aberrant placentaldevelopmentinSCNT-inducedbovine pregnancies.SCNT-derived cattle exhibited placental hypertrophy,including enlarged abdominal circumference and altered placental cotyledon morphology.RNA sequencing analysis indicated significant dysregulation of Hippo signaling pathway genes in SCNT placentas.Coexpression of YAP1 and CCND1 was observed in cloned blastocysts,placental tissues,and bovine placental mesenchymal stem cells(bPMSCs).Manipulation of YAP1expression demonstrated the capacity to regulate bPMSC proliferation.Experimental assays confirmed the direct binding of YAP1 to CCND1,which subsequently promoted CCND1 expression in bPMSCs.Furthermore,inhibition of CDK6,a downstream target of CCND1,attenuated SCNT bPMSC proliferation.This study identified YAP1 as a key regulatory component within the Hippo signaling pathway that drives placental hyperplasia in cloned cattle through up-regulation of CCND1-CDK6 expression,facilitating cell cycle progression.These findings offer potential avenues for enhancing cloning efficiency,with implications for evolutionary biology and the conservation of valuable germplasm resources.展开更多
Double sex and mab-3-related transcription factor 1(Dmrt1),which is expressed in goat male germline stem cells(mGSCs)and Sertoli cells,is one of the most conserved transcription factors involved in sex determination.I...Double sex and mab-3-related transcription factor 1(Dmrt1),which is expressed in goat male germline stem cells(mGSCs)and Sertoli cells,is one of the most conserved transcription factors involved in sex determination.In this study,we highlighted the role of Dmrt1 in balancing the innate immune response in goat mGSCs.Dmrt1 recruited promyelocytic leukemia zinc finger(Plzf),also known as zinc finger and BTB domain-containing protein 16(Zbtb16),to repress the Toll-like receptor 4(TLR4)-dependent inflammatory signaling pathway and nuclear factor(NF)-κB.Knockdown of Dmrt1 in seminiferous tubules resulted in widespread degeneration of germ and somatic cells,while the expression of proinflammatory factors were significantly enhanced.We also demonstrated that Dmrt1 stimulated proliferation of mGSCs,but repressed apoptosis caused by the immune response.Thus,Dmrt1 is sufficient to reduce inflammation in the testes,thereby establishing the stability of spermatogenesis and the testicular microenvironment.展开更多
The Boer goat is one of the top meat breeds in modern animal husbandry and has attracted widespread attention for its unique growth performance.However,the genetic basis of muscle development in the Boer goat remains ...The Boer goat is one of the top meat breeds in modern animal husbandry and has attracted widespread attention for its unique growth performance.However,the genetic basis of muscle development in the Boer goat remains obscure.In this study,we identified specific structural variants in the Boer goat based on genome-wide selection signals and analyzed the basis of the molecular heredity of related candidate genes in muscle development.A total of9 959 autosomal copy number variations(CNVs) were identified through selection signal analysis in 127 goat genomes.Specifically,we confirmed that the highest signal CNV(HSV) was a chromosomal arrangement containing an approximately 1.11 Mb(CHIR17:60062304-61171840 bp) duplicated fragment inserted in reverse orientation and a 5 362 bp deleted region(CHIR17:60145940-60151302 bp) with overlapping genes(e.g.,ARHGAP10,NR3C2,EDNRA,PRMT9,and TMEM184C).The homozygous duplicated HSV genotype(+/+) was found in 96% of Boer goats but was not detected in Eurasian goats and was only detected in 4% of indigenous African goats.The expression network of three candidate genes(ARHGAP10,NR3C2,and EDNRA)regulating dose transcription was constructed by RNA sequencing.Results indicated that these genes were involved in the proliferation and differentiation of skeletal muscle satellite cells(SMSCs) and their overexpression significantly increased the expression of SAA3.The HSV of the Boer goat contributed to superior skeletal muscle growth via the dose effects of overlapping genes.展开更多
The increasing emergence of the time-series single-cell RNA sequencing(scRNA-seq)data,inferring developmental trajectory by connecting transcriptome similar cell states(i.e.,cell types or clusters)has become a major c...The increasing emergence of the time-series single-cell RNA sequencing(scRNA-seq)data,inferring developmental trajectory by connecting transcriptome similar cell states(i.e.,cell types or clusters)has become a major challenge.Most existing computational methods are designed for individual cells and do not take into account the available time series information.We present IDTI based on the Increment of Diversity for Trajectory Inference,which combines time series information and the minimum increment of diversity method to infer cell state trajectory of time-series scRNA-seq data.We apply IDTI to simulated and three real diverse tissue development datasets,and compare it with six other commonly used trajectory inference methods in terms of topology similarity and branching accuracy.The results have shown that the IDTI method accurately constructs the cell state trajectory without the requirement of starting cells.In the performance test,we further demonstrate that IDTI has the advantages of high accuracy and strong robustness.展开更多
DNA methylation at non-CG dinucleotides(mCH,H=A,C,T)widely occurs and plays an important role in specific cell types,including pluripotent,neural,and germ cells.However,the functions and regulatory mechanisms of mCH,p...DNA methylation at non-CG dinucleotides(mCH,H=A,C,T)widely occurs and plays an important role in specific cell types,including pluripotent,neural,and germ cells.However,the functions and regulatory mechanisms of mCH,particularly in species other than humans and mice,remain inadequately explored.In this study,we analyzed the distribution of mCH across different bovine tissues,identifying significantly elevated mCH levels in bovine embryonic stem cells(bESCs),as well as brain,spleen,and ileum tissues compared to other tissues.Marked differences in mCH patterns between somatic cells and bESCs were observed,reflecting distinct base preferences and the differential expression of DNA methyltransferases.We also identified exon methylation in both CG and nonCG contexts,resembling gene-associated methylation patterns observed in plants.To characterize tissue-specific variations in mCH,we developed a novel method for differential mCH analysis.Results indicated that mCH is not randomly distributed but tends to be enriched in tissuespecific functional regions.Furthermore,regression models demonstrated a positional correlation between CG methylation and mCH.This study enhances our understanding of mCH distribution and function in bovine somatic and stem cells,providing new insights into its potential roles across species and tissues.These findings advance knowledge of epigenetic mechanisms,shedding light on the potential involvement of mCH in development and disease processes.展开更多
Alternative polyadenylation(APA)of mRNA is a widespread transcriptomic mechanism which fine-tunes gene expression and plays important roles in diverse biological processes.Of the different APA types,intronic polyadeny...Alternative polyadenylation(APA)of mRNA is a widespread transcriptomic mechanism which fine-tunes gene expression and plays important roles in diverse biological processes.Of the different APA types,intronic polyadenylation is a prevalent but not well understood one.Although the upstream regulation of intronic polyadenylation is extensively investigated,the understanding of its biological function largely lags behind.Here,we discovered that intronic polyadenylation of glutaminase-encoding gene Glutaminase(GLS)generated an isoform termed Glutaminase C(GAC,encoding glutaminase C),which played regulatory roles in cellular senescence,the basis of individual aging and also an important anti-cancer mechanism.Reduced usage of GLS intronic polyadenylation(pA)site was consistent in both human and mouse senescence models.GAC protein mainly located in mitochondria,and downregulation of GAC induced cellular senescence in both human and mouse cells.Increased reactive oxygen species(ROS)level and decreased ATP synthesis explained the senescence-associated phenotypes in GAC deficient cells.Polyadenylation factor CPSF6 bound to the last exon of GAC to regulate its expression.Rescue experiment confirmed that CPSF6-GAC signal axis did play important roles in regulating cellular senescence.Together,the present study demonstrated for the first time that intronic polyadenylation could regulate cellular senescence,largely extending our understanding of the biological roles of intronic polyadenylation.展开更多
Transcription attenuation in response to the availability of a specific amino acid is believed to be controlled by alternative configurations of RNA secondary structures that lead to the arrest of translation or the r...Transcription attenuation in response to the availability of a specific amino acid is believed to be controlled by alternative configurations of RNA secondary structures that lead to the arrest of translation or the release of the arrested ribosome from the leader mRNA molecule.In this study,we first report a possible example of the DnaA‐dependent riboswitch for transcription attenuation in Escherichia coli.We show that(i)DnaA regulates the transcription of the structural genes but not that of the leader hisL gene;(ii)DnaA might bind to rDnaA boxes present in the HisL‐SL RNA,and subsequently attenuate the transcription of the operon;(iii)the HisL‐SL RNA and rDnaA boxes are phylogenetically conserved and evolutionarily important;and(iv)the translating ribosome is required for deattenuation of the his operon,whereas tRNA^(His) strengthens attenuation.This mechanism seems to be phylogenetically conserved in Gram‐negative bacteria and evolutionarily important.展开更多
The Shroom(Shrm)family of actin-binding proteins has a unique and highly conserved Apx/Shrm Domain 2(ASD2)motif.Shroom protein directs the subcellular localization of Rho-associated kinase(ROCK),which remodels the act...The Shroom(Shrm)family of actin-binding proteins has a unique and highly conserved Apx/Shrm Domain 2(ASD2)motif.Shroom protein directs the subcellular localization of Rho-associated kinase(ROCK),which remodels the actomyosin cytoskeleton and changes cellular morphology via its ability to phosphorylate and activate non-muscle myosin II.Therefore,the Shrm-ROCK complex is critical for the cellular shape and the development of many tissues,including the neural tube,eye,intestines,heart,and vasculature system.Importantly,the structure and expression of Shrm proteins are also associated with neural tube defects,chronic kidney disease,metastasis of carcinoma,and X-link mental retardation.Therefore,a better understanding of Shrm-mediated signaling transduction pathways is essential for the development of new therapeutic strategies to minimize damage resulting in abnormal Shrm proteins.This paper provides a comprehensive overview of the various Shrm proteins and their roles in morphogenesis and disease.展开更多
Our previous study demonstrated that GSK3 plays an indispensable role in the expansion of effector CD8+T cells and the regulation of T-cell exhaustion.GSK3 controls T-cell exhaustion by regulating TCR-mediated NFAT ac...Our previous study demonstrated that GSK3 plays an indispensable role in the expansion of effector CD8+T cells and the regulation of T-cell exhaustion.GSK3 controls T-cell exhaustion by regulating TCR-mediated NFAT activation through promoting the nuclear export of NFAT,thereby restraining NFAT-induced expression of exhaustion-associated genes,including TOX/TOX2 and PD-1[1].We thank Dr.Rudd et al.for their careful consideration of our study.They raised very important and critical concerns,and we address these concerns individually below.展开更多
Drug resistance to a single agent is common in cancer-targeted therapies,and rational drug combinations are a promising approach to overcome this challenge.Many Food and Drug Administration-approved drugs can induce c...Drug resistance to a single agent is common in cancer-targeted therapies,and rational drug combinations are a promising approach to overcome this challenge.Many Food and Drug Administration-approved drugs can induce cellular senescence,which possesses unique vulnerabilities and molecular signatures.However,there is limited analysis on the effect of the combination of cellular-senescence-inducing drugs and targeted therapy drugs.Here,we conducted a comprehensive evaluation of cellular senescence using 7 senescence-associated gene sets.We quantified the cellular senescence states of~10,000 tumor samples from The Cancer Genome Atlas and examined their associations with targeted drug responses.Our analysis revealed that tumors with higher cellular senescence scores exhibited increased sensitivity to targeted drugs.As a proof of concept,we experimentally confirmed that etoposide-induced senescence sensitized lung cancer cells to 2 widely used targeted drugs,erlotinib and dasatinib.Furthermore,we identified multiple genes whose dependencies were associated with senescence status across~1,000 cancer cell lines,suggesting that cellular senescence generates unique vulnerabilities for therapeutic exploitation.Our study provides a comprehensive overview of drug response related to cellular senescence and highlights the potential of combining senescence-inducing agents with targeted therapies to improve treatment outcomes in lung cancer,revealing novel applications of cellular senescence in targeted cancer therapies.展开更多
How a mammalian fertilized egg acquires totipotency and develops into a full-term offspring is a fundamental scientific question.Human embryonic development is difficult to study due to limited resources,technical cha...How a mammalian fertilized egg acquires totipotency and develops into a full-term offspring is a fundamental scientific question.Human embryonic development is difficult to study due to limited resources,technical challenges and ethics.Moreover,the precise regulatory mechanism underlying early human embryonic development remains unknown.In recent years,the emergence of stem cell-based embryo models(SCBEM)provides the opportunity to reconstitute pre-to post-implantation development in vitro.These models to some extent mimic the embryo morphologically and transcriptionally,and thus may be used to study key events in mammalian pre-and post-implantation development.Many groups have successfully generated SCBEM of the mouse and human.Here,we provide a comparative review of the mouse and human SCBEM,discuss the capability of these models to mimic natural embryos and give a perspective on their potential future applications.展开更多
Ubiquitination is a highly conserved and fundamental posttranslational modification(PTM)in all eukaryotes regulating thousands of proteins.The RING(really interesting new gene)finger(RNF)protein,containing the RING do...Ubiquitination is a highly conserved and fundamental posttranslational modification(PTM)in all eukaryotes regulating thousands of proteins.The RING(really interesting new gene)finger(RNF)protein,containing the RING domain,exerts E3 ubiquitin ligase that mediates the covalent attachment of ubiquitin(Ub)to target proteins.Multiple reviews have summarized the critical roles of the tripartite-motif(TRIM)protein family,a subgroup of RNF proteins,in various diseases,including cancer,inflammatory,infectious,and neuropsychiatric disorders.Except for TRIMs,since numerous studies over the past decades have delineated that other RNF proteins also exert widespread involvement in several diseases,their importance should not be underestimated.This review summarizes the potential contribution of dysregulated RNF proteins,except for TRIMs,to the pathogenesis of some diseases,including cancer,autoimmune diseases,and neurodegenerative disorder.Since viral infection is broadly involved in the induction and development of those diseases,this manuscript also highlights the regulatory roles of RNF proteins,excluding TRIMs,in the antiviral immune responses.In addition,we further discuss the potential intervention strategies targeting other RNF proteins for the prevention and therapeutics of those human diseases.展开更多
Dear Editor,Embryonic stem cells(ESCs)and trophoblast stem cells(TSCs)are derived from blastocysts(Lu et al.,2001).Blastocyst-like structures(blastoids)are self-assembled structures formed by a combination of ESCs and...Dear Editor,Embryonic stem cells(ESCs)and trophoblast stem cells(TSCs)are derived from blastocysts(Lu et al.,2001).Blastocyst-like structures(blastoids)are self-assembled structures formed by a combination of ESCs and TSCs(Rivron et al.,2018).To increase the success rate of blastoid formation and its similarity with the features of blastocysts,some reports showed that blastoid could also be derived from a combination of three cell lines,ESCs,TSCs,and extraembryonic endoderm cells(XENs),or novel type of stem cells(Sozen et al.,2018;Weatherbee et al.,2023:Wu et al.,2023;Zhang et al.,2023;Zhang et al.,2019).展开更多
基金supported by the National Natural Science Foundation of China(32360837 and 32341052)the STI2030 Major Projects,China(2023ZW0404803)+8 种基金the Inner Mongolia Open Competition Projects,China(2022JBGS0025)the Inner Mongolia Science and Technology Leading Team,China(2022LJRC0006)the Inner Mongolia Science and Technology Major Projects,China(2021ZD0009,2021ZD0008,2022ZD0008,2023KJHZ0028)the Inner Mongolia Young Talents Projects,China(NJYT23138)the Inner Mongolia Natural Science Foundation,China(2023MS03004)the Central Government Guides Development,China(2022ZY0212)the National Agricultural Science and Technology Project of China(NK2022130203)the Collaborative Innovation among Universities in Hohhot,China(XTCX2023-06)the Ministry of Education Engineering Centre Project,China(JYBGCSYS2022)。
文摘Myostatin(MSTN)is principally expressed in skeletal muscle and negatively regulates muscle growth and development.MSTN mutation can induce muscle overgrowth in cattle by activating cell proliferation,presenting a“double-muscle”phenotype.However,the specific regulatory mechanism is still unclear.Here,we found that Ca^(2+)content in muscle tissue and muscle satellite cells of MSTN mutated(MSTN^(–/–))cattle were significantly increased compared to wild-type(WT).Furthermore,transcriptome analysis of muscle satellite cells revealed that TRPC4 was significantly increased in MSTN^(–/–)cattle.And the expression of TRPC4 in muscle tissue of MSTN^(–/–)cattle was detected by RT-qPCR and Western blot,which was significantly higher than that of WT.These results suggested that MSTN mutation promoted muscle satellite cells proliferation through activation of TRPC4 channel.To further verify,ML204,a specific inhibitor of TRPC4,was used to treat MSTN^(–/–)muscle satellite cells.We found that cell proliferation was inhibited,calcineurin expression was downregulated,and the entry of NFATc3 into nuclei was reduced,which was similar to WT group.Thus,MSTN mutation leads to the activation of TRPC4 channel,which increases intracellular Ca^(2+)content,further activates calcineurin/NFATc3 pathway,and ultimately promotes the proliferation of muscle satellite cells.
基金supported by the National Natural Science Foundation of China(Grant No.32160172)the Key Science-Technology Project of Inner Mongolia(2023KYPT0010)+1 种基金the Natural Science Foundation of Inner Mongolia Autonomous Region of China(Grant No.2025QN03006)the 2023 Inner Mongolia Public Institution High-Level Talent Introduction Scientific Research Support Project.
文摘Environmental DNA(eDNA)technology has revolutionized biodiversity monitoring with its non-invasive,sensitive,and cost-efficient approach.This paper systematically reviews eDNA advancements,examining its applications in aquatic and terrestrial ecosystems and assessing China’s standardization progress.It delineates four developmental phases from single-species detection to high-throughput sequencing,and highlights China’s contribution to the development of technical standards.While significant progress has been made,challenges persist in quantitative accuracy,methodological consistency,and large-scale implementation.Future efforts should prioritize enhanced standardization,improved quantification techniques,broader applications,and international collaboration to drive innovation in eDNA technology.
基金financially supported by the National Key R&D Program of China(2023YFC3603300,2021YFA0909300)National Natural Science Foundation of China(92249302,32370592,32400437)China Postdoctoral Science Foundation(BX20230073 and 2023M740709)。
文摘Somatic variants in the cancer genome influence gene expression through diverse mechanisms depending on their specific locations.However,a systematic evaluation of the effects of somatic variants located in 3'untranslated regions(3'UTRs)on alternative polyadenylation(APA)of m RNA remains lacking.In this study,we analyze 10,199 tumor samples across 32 cancer types and identify 1333 somatic single nucleotide variants(SNVs)associated with abnormal 3'UTR APA.Mechanistically,these 3'UTR SNVs can alter cisregulatory elements,such as the poly(A)signal and UGUA motif,leading to changes in APA.Minigene assays confirm that 3'UTR SNVs in multiple genes,including RPS23 and CHTOP,induce aberrant APA.Among affected genes,62 exhibit differential stability between tandem 3'UTR isoforms,including HSPA4and UCK2,validated by experimental assays.Finally,we establish that SNV-related abnormal APA usage serves as an additional layer of expression regulation for tumor-suppressor gene HMGN2 in breast cancer.Collectively,this study reveals 3'UTR APA as a critical mechanism mediating the functional impact of somatic noncoding variants in human cancers.
基金supported by the National Natural Science Foundation of China(Grant No.32160172)the Key Science-Technology Project of Inner Mongolia(2023KYPT0010)+1 种基金the Natural Science Foundation of Inner Mongolia Autonomous Region of China(Grant No.2025QN03006)the 2023 Inner Mongolia Public Institution High-level Talent Introduction Scientific Research Support Project.
文摘This study establishes and validates a method for the precise quantification of aquatic microbial loads using microbial diversity absolute quantitative sequencing.By adding synthetic spike-in DNA to water samples from the Dahei River prior to DNA extraction and 16S rRNA gene sequencing,it generates standard curves to convert sequencing data into absolute microbial copy numbers.The method,which is proved highly accurate(R^(2)>0.99),reveals a clear contrast between the river sites:the upstream community has not only a significantly higher total microbial load but also a completely different makeup of species compared to the downstream site.This approach effectively overcomes the limitations of relative abundance analysis,providing a powerful tool for environmental monitoring,and proposes key steps for future standardization to ensure data comparability and integration.
基金supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001)the National Natural Science Foundation of China (81471001)the Inner Mongolia Science and Technology Program, China (201502073)
文摘The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
基金supported by the National Transgenic Project of China (2016ZX08010001-002)the National Natural Science Foundation of China (81471001)+1 种基金the Inner Mongolia Science and Technology Program, China (201502073)the National 863 Prgram of China (2009AA10Z111)
文摘This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat(CRISPR)/Cas9-mediated gene knock-ins with zinc finger nucleases(ZFNs) and transcription activator-like effector nucleases(TALENs) in bovine and dairy goat fetal fibroblasts. To test the knock-in efficiency, a set of ZFNs and CRISPR/Cas9 plasmids were designed to edit the bovine myostatin(MSTN) gene at exon 2, while a set of TALENs and CRISPR/Cas9 plasmids were designed for editing the dairy goat β-casein gene at exon 2. Donor plasmids utilizing the ZFNs, TALENs, and CRISPR/Cas9 cutting sites were constructed in theGFP-PGK-Neo R plasmid background, including a 5′ and 3′ homologous arm flanking the genes humanized Fat-1(h Fat-1) or enhanced green fluorescent protein(eGFP). Subsequently, the ZFNs, TALENs, or CRISPR/Cas9 and thehFat-1 or eGFP plasmids were co-transfected by electroporation into bovine and dairy goat fetal fibroblasts. After G418(Geneticin) selection, single cells were obtained by mouth pipetting, flow cytometry or a cell shove. The gene knock-in events were screened by PCR across the homologous arms. The results showed that in bovine fetal fibrobalsts, the efficiencies of ZFNs-mediated eGFP andhFat-1 gene knock-ins were 13.68 and 0%, respectively. The efficiencies of CRISPR/Cas9-mediated eGFP andhFat-1 gene knock-ins were 77.02 and 79.01%, respectively. The eGFP gene knock-in efficiency using CRISPR/Cas9 was about 5.6 times higher than when using the ZFNs gene editing system. Additionally, thehFat-1 gene knock-in was only obtained when using the CRISPR/Cas9 system. The difference of knockin efficiencies between the ZFNs and CRISPR/Cas9 systems were extremely significant(P〈0.01). In the dairy goat fetal fibroblasts, the efficiencies of TALENs-mediated eGFP andhFat-1 gene knock-ins were 32.35 and 26.47%, respectively. Theefficiencies of eGFP and hFat-1 gene knock-ins using CRISPR/Cas9 were 70.37 and 74.29%, respectively. The knock-in efficiencies difference between the TALENs and CRISPR/Cas9 systems were extremely significant(P〈0.01). This study demonstrated that CRISPR/Cas9 was more efficient at gene knock-ins in domesticated animal cells than ZFNs and TALENs. The CRISPR/Cas9 technology offers a new era of precise gene editing in domesticated animal cell lines.
基金financially supported by the Science and Technology Major Project of the Inner Mongolia Autonomous Region of China(2020ZD0007)the Major Program of the Inner Mongolia Natural Science Foundation,China(2020ZD10)+3 种基金the National Natural Science Foundation of China(32160172)the Natural Science Foundation of Inner Mongolia Autonomous Region(2020BS03003 and 2020BS03022)the National Transgenic Project of China(2016ZX0801000-002 and 2016ZX08010005-001)the Science and Technology Major Project of the Inner Mongolia Autonomous Region of China(zdzx2018065)。
文摘Lysophosphatidic acid(LPA)is a small molecule glycerophospholipid,which regulates multiple downstream signalling pathways through G-protein-coupled receptors to achieve numerous functions on oocyte maturation and embryo development.In this study,sheep in vitro fertilized embryos were applied to investigate the effects of LPA on early embryos development and embryonic stem cell establishment.At first,the maturation medium containing estrus female sheep serum and synthetic oviduct fluid(SOF)were optimized for sheep IVF,and then the effects of LPA were investigated.From 0.1 to 10μmol L^(–1),LPA had no significant effect on the cleavage rate(P>0.05),but the maturation rate and blastocyst rate increased dependently with LPA concentration(P<0.05),and the blastocyst morphology was normal.When the LPA concentration was 15μmol L^(–1),the maturation rate,cleavage rate and blastocyst rate decreased significantly(P<0.05),and the blastocyst exhibited abnormal morphology and could not develop into highquality blastocyst.Besides,the exogenous LPA increases the expression of LPAR2,LPAR4,TE-related gene CDX-2and pluripotency-related gene OCT-4 in sheep early IVF embryos with the raise of LPA concentration from 0.1 to 10μmol L^(–1).The expression of LPAR2,LPAR4,CDX-2 and OCT-4 from the LPA-0.1μmol L^(–1)to LPA-10μmol L^(–1)groups in early embryos were extremely significant(P<0.05),while the expression of these genes significantly decreased in 15μmol L^(–1)LPA-treated embryos compared with LPA-10μmol L^(–1)group(P<0.05).The inner cell mass in 15μmol L^(–1)LPA-treated embryos was also disturbed,and the blastocysts formation was abnormal.Secondly,the sheep IVF blastocysts were applied to establish embryonic stem cells.The results showed that LPA made the blastocyst inoculated cells grow towards TSC-like cells.They enhanced the fluorescence intensity and mRNA abundance of OCT-4 and CDX-2 as the concentration increased from 0 to 10μmol L^(–1),while 15μmol L^(–1)LPA decreased OCT-4 and CDX-2 expression in the derived cells.The expression of CDX-2 and OCT-4 in the blastocyst inoculated cells of LPA-1μmol L^(–1)group and LPA-10μmol L^(–1)group extremely significantly increased(P<0.05),but there was significant decrease in LPA-15μmol L^(–1)group compared with LPA-10μmol L^(–1)group(P<0.05).Meanwhile,the protein expression of LPAR2 and LPAR4 remarkably increased after treatment of LPA at 10μmol L^(–1)concentration.This study references the IVF embryo production and embryonic stem cell research of domestic animals.
基金supported by the National Natural Science Foundation of China (32060755)Natural Science Foundation of Inner Mongolia (2024MS03001)+7 种基金Inner Mongolia Autonomous Region Open Competition Projects (2022JBGS0018)Program for Young Talents of Science and Technology in Universities of Inner Mongolia Autonomous Region (NJYT23090)Inner Mongolia Autonomous Region Science and Technology Leading Team (2022LJRC0006)Inner Mongolia Autonomous Region Science and Technology Major Project (2021ZD0009)Major Agricultural Science and Technology Project of the Ministry of Agriculture and Rural Affairs (NK2022130203)Central Government Guides Local Science and Technology Development Funds (2022ZY0212)Inner Mongolia Autonomous Region High-level Talent Support ProgramInner Mongolia University Chief Scientist Program。
文摘Somatic cell nuclear transfer(SCNT)has been successfully employed across various mammalian species,yet cloned animals consistently exhibit low pregnancy rates,primarily due to placental abnormalities such as hyperplasia and hypertrophy.This study investigated the involvement of the Hippo signaling pathway in aberrant placentaldevelopmentinSCNT-inducedbovine pregnancies.SCNT-derived cattle exhibited placental hypertrophy,including enlarged abdominal circumference and altered placental cotyledon morphology.RNA sequencing analysis indicated significant dysregulation of Hippo signaling pathway genes in SCNT placentas.Coexpression of YAP1 and CCND1 was observed in cloned blastocysts,placental tissues,and bovine placental mesenchymal stem cells(bPMSCs).Manipulation of YAP1expression demonstrated the capacity to regulate bPMSC proliferation.Experimental assays confirmed the direct binding of YAP1 to CCND1,which subsequently promoted CCND1 expression in bPMSCs.Furthermore,inhibition of CDK6,a downstream target of CCND1,attenuated SCNT bPMSC proliferation.This study identified YAP1 as a key regulatory component within the Hippo signaling pathway that drives placental hyperplasia in cloned cattle through up-regulation of CCND1-CDK6 expression,facilitating cell cycle progression.These findings offer potential avenues for enhancing cloning efficiency,with implications for evolutionary biology and the conservation of valuable germplasm resources.
基金This work was supported by the China National Basic Research Program(2016YFA0100203)National Natural Science Foundation of China(31572399Detail,32072806,32072815,32002246)+3 种基金State Key Lab of Reproductive Regulation&Breeding of Grassland Livestock(SKL-OT-201801)Science and Technology Major Project of Inner Mongolia Autonomous Region of China(ZDZX2018065)and Shaanxi Province Science and Technology Innovation Team(2019TD-036)The authors thank Dr.John Clotaire Daguia Zambe for helpful comments about this paper,Jia Fang for the PGL3-NF-κB luciferase reporter plasmid,and Dong-Xue Che for bioinformatics analysis.
文摘Double sex and mab-3-related transcription factor 1(Dmrt1),which is expressed in goat male germline stem cells(mGSCs)and Sertoli cells,is one of the most conserved transcription factors involved in sex determination.In this study,we highlighted the role of Dmrt1 in balancing the innate immune response in goat mGSCs.Dmrt1 recruited promyelocytic leukemia zinc finger(Plzf),also known as zinc finger and BTB domain-containing protein 16(Zbtb16),to repress the Toll-like receptor 4(TLR4)-dependent inflammatory signaling pathway and nuclear factor(NF)-κB.Knockdown of Dmrt1 in seminiferous tubules resulted in widespread degeneration of germ and somatic cells,while the expression of proinflammatory factors were significantly enhanced.We also demonstrated that Dmrt1 stimulated proliferation of mGSCs,but repressed apoptosis caused by the immune response.Thus,Dmrt1 is sufficient to reduce inflammation in the testes,thereby establishing the stability of spermatogenesis and the testicular microenvironment.
基金supported by the National Natural Science Foundation of China (32272834)。
文摘The Boer goat is one of the top meat breeds in modern animal husbandry and has attracted widespread attention for its unique growth performance.However,the genetic basis of muscle development in the Boer goat remains obscure.In this study,we identified specific structural variants in the Boer goat based on genome-wide selection signals and analyzed the basis of the molecular heredity of related candidate genes in muscle development.A total of9 959 autosomal copy number variations(CNVs) were identified through selection signal analysis in 127 goat genomes.Specifically,we confirmed that the highest signal CNV(HSV) was a chromosomal arrangement containing an approximately 1.11 Mb(CHIR17:60062304-61171840 bp) duplicated fragment inserted in reverse orientation and a 5 362 bp deleted region(CHIR17:60145940-60151302 bp) with overlapping genes(e.g.,ARHGAP10,NR3C2,EDNRA,PRMT9,and TMEM184C).The homozygous duplicated HSV genotype(+/+) was found in 96% of Boer goats but was not detected in Eurasian goats and was only detected in 4% of indigenous African goats.The expression network of three candidate genes(ARHGAP10,NR3C2,and EDNRA)regulating dose transcription was constructed by RNA sequencing.Results indicated that these genes were involved in the proliferation and differentiation of skeletal muscle satellite cells(SMSCs) and their overexpression significantly increased the expression of SAA3.The HSV of the Boer goat contributed to superior skeletal muscle growth via the dose effects of overlapping genes.
基金the National Natural Science Foundation of China(62061034,62171241)the key technology research program of Inner Mongolia Autonomous Region(2021GG0398)the Science and Technology Leading Talent Team in Inner Mongolia Autonomous Region(2022LJRC0009).
文摘The increasing emergence of the time-series single-cell RNA sequencing(scRNA-seq)data,inferring developmental trajectory by connecting transcriptome similar cell states(i.e.,cell types or clusters)has become a major challenge.Most existing computational methods are designed for individual cells and do not take into account the available time series information.We present IDTI based on the Increment of Diversity for Trajectory Inference,which combines time series information and the minimum increment of diversity method to infer cell state trajectory of time-series scRNA-seq data.We apply IDTI to simulated and three real diverse tissue development datasets,and compare it with six other commonly used trajectory inference methods in terms of topology similarity and branching accuracy.The results have shown that the IDTI method accurately constructs the cell state trajectory without the requirement of starting cells.In the performance test,we further demonstrate that IDTI has the advantages of high accuracy and strong robustness.
基金supported by the STI 2030-Major Projects(2023ZD0407504)of ChinaDevelopment Plan for Young Scientific and Technological Talents in Colleges and Universities of Inner Mongolia Autonomous Region of China(NMGIRT2204)+1 种基金National Natural Science Foundation of China(32160172)Science and Technology Major Project of the Inner Mongolia Autonomous Region of China to the State Key Laboratory of Reproductive Regulation(2021ZD0048&2023KYPT0010)。
文摘DNA methylation at non-CG dinucleotides(mCH,H=A,C,T)widely occurs and plays an important role in specific cell types,including pluripotent,neural,and germ cells.However,the functions and regulatory mechanisms of mCH,particularly in species other than humans and mice,remain inadequately explored.In this study,we analyzed the distribution of mCH across different bovine tissues,identifying significantly elevated mCH levels in bovine embryonic stem cells(bESCs),as well as brain,spleen,and ileum tissues compared to other tissues.Marked differences in mCH patterns between somatic cells and bESCs were observed,reflecting distinct base preferences and the differential expression of DNA methyltransferases.We also identified exon methylation in both CG and nonCG contexts,resembling gene-associated methylation patterns observed in plants.To characterize tissue-specific variations in mCH,we developed a novel method for differential mCH analysis.Results indicated that mCH is not randomly distributed but tends to be enriched in tissuespecific functional regions.Furthermore,regression models demonstrated a positional correlation between CG methylation and mCH.This study enhances our understanding of mCH distribution and function in bovine somatic and stem cells,providing new insights into its potential roles across species and tissues.These findings advance knowledge of epigenetic mechanisms,shedding light on the potential involvement of mCH in development and disease processes.
基金supported by the National Natural Science Foundation of China(92249302,32370592)the National Key Research and Development Program of China(2023YFC3603300,2021YFA0909300)the Natural Science Foundation Project of Shanghai(21ZR1407000).
文摘Alternative polyadenylation(APA)of mRNA is a widespread transcriptomic mechanism which fine-tunes gene expression and plays important roles in diverse biological processes.Of the different APA types,intronic polyadenylation is a prevalent but not well understood one.Although the upstream regulation of intronic polyadenylation is extensively investigated,the understanding of its biological function largely lags behind.Here,we discovered that intronic polyadenylation of glutaminase-encoding gene Glutaminase(GLS)generated an isoform termed Glutaminase C(GAC,encoding glutaminase C),which played regulatory roles in cellular senescence,the basis of individual aging and also an important anti-cancer mechanism.Reduced usage of GLS intronic polyadenylation(pA)site was consistent in both human and mouse senescence models.GAC protein mainly located in mitochondria,and downregulation of GAC induced cellular senescence in both human and mouse cells.Increased reactive oxygen species(ROS)level and decreased ATP synthesis explained the senescence-associated phenotypes in GAC deficient cells.Polyadenylation factor CPSF6 bound to the last exon of GAC to regulate its expression.Rescue experiment confirmed that CPSF6-GAC signal axis did play important roles in regulating cellular senescence.Together,the present study demonstrated for the first time that intronic polyadenylation could regulate cellular senescence,largely extending our understanding of the biological roles of intronic polyadenylation.
基金supported by grants from the National Natural Science Foundation of China(Grant no.32260233 to Morigen)the Science and Technology Foundation of Inner Mongolia(Inner Mongolia Key Laboratory for Molecular Regulation of the Cell,Grant no.2021PT0002).
文摘Transcription attenuation in response to the availability of a specific amino acid is believed to be controlled by alternative configurations of RNA secondary structures that lead to the arrest of translation or the release of the arrested ribosome from the leader mRNA molecule.In this study,we first report a possible example of the DnaA‐dependent riboswitch for transcription attenuation in Escherichia coli.We show that(i)DnaA regulates the transcription of the structural genes but not that of the leader hisL gene;(ii)DnaA might bind to rDnaA boxes present in the HisL‐SL RNA,and subsequently attenuate the transcription of the operon;(iii)the HisL‐SL RNA and rDnaA boxes are phylogenetically conserved and evolutionarily important;and(iv)the translating ribosome is required for deattenuation of the his operon,whereas tRNA^(His) strengthens attenuation.This mechanism seems to be phylogenetically conserved in Gram‐negative bacteria and evolutionarily important.
文摘The Shroom(Shrm)family of actin-binding proteins has a unique and highly conserved Apx/Shrm Domain 2(ASD2)motif.Shroom protein directs the subcellular localization of Rho-associated kinase(ROCK),which remodels the actomyosin cytoskeleton and changes cellular morphology via its ability to phosphorylate and activate non-muscle myosin II.Therefore,the Shrm-ROCK complex is critical for the cellular shape and the development of many tissues,including the neural tube,eye,intestines,heart,and vasculature system.Importantly,the structure and expression of Shrm proteins are also associated with neural tube defects,chronic kidney disease,metastasis of carcinoma,and X-link mental retardation.Therefore,a better understanding of Shrm-mediated signaling transduction pathways is essential for the development of new therapeutic strategies to minimize damage resulting in abnormal Shrm proteins.This paper provides a comprehensive overview of the various Shrm proteins and their roles in morphogenesis and disease.
文摘Our previous study demonstrated that GSK3 plays an indispensable role in the expansion of effector CD8+T cells and the regulation of T-cell exhaustion.GSK3 controls T-cell exhaustion by regulating TCR-mediated NFAT activation through promoting the nuclear export of NFAT,thereby restraining NFAT-induced expression of exhaustion-associated genes,including TOX/TOX2 and PD-1[1].We thank Dr.Rudd et al.for their careful consideration of our study.They raised very important and critical concerns,and we address these concerns individually below.
基金financially supported by the National Key Research and Development Program of China(2023YFC3603300 and 2021YFA0909300)the National Natural Science Foundation of China(92249302,32400437,and 32370592)the Shanghai Municipal Science and Technology Major Project(Grant No.2023SHZDZX02).
文摘Drug resistance to a single agent is common in cancer-targeted therapies,and rational drug combinations are a promising approach to overcome this challenge.Many Food and Drug Administration-approved drugs can induce cellular senescence,which possesses unique vulnerabilities and molecular signatures.However,there is limited analysis on the effect of the combination of cellular-senescence-inducing drugs and targeted therapy drugs.Here,we conducted a comprehensive evaluation of cellular senescence using 7 senescence-associated gene sets.We quantified the cellular senescence states of~10,000 tumor samples from The Cancer Genome Atlas and examined their associations with targeted drug responses.Our analysis revealed that tumors with higher cellular senescence scores exhibited increased sensitivity to targeted drugs.As a proof of concept,we experimentally confirmed that etoposide-induced senescence sensitized lung cancer cells to 2 widely used targeted drugs,erlotinib and dasatinib.Furthermore,we identified multiple genes whose dependencies were associated with senescence status across~1,000 cancer cell lines,suggesting that cellular senescence generates unique vulnerabilities for therapeutic exploitation.Our study provides a comprehensive overview of drug response related to cellular senescence and highlights the potential of combining senescence-inducing agents with targeted therapies to improve treatment outcomes in lung cancer,revealing novel applications of cellular senescence in targeted cancer therapies.
基金supported by the National Science and Technology Major Project(2023ZD0405001)the National Natural Science Foundation of China(32460837 and 32060176)+3 种基金the Program for Young Talents of Science and Technology in Universities of Inner Mongolia Autonomous Region(NJYT23091)the National Key Research and Development Program of China(2022YFD1302202)the Program of“JIE BANG GUA SHUAI”of Inner Mongolia(2022JBGS0021)the Program of Higher-Level Talents of Inner Mongolia University(10000-21311201/058)。
文摘How a mammalian fertilized egg acquires totipotency and develops into a full-term offspring is a fundamental scientific question.Human embryonic development is difficult to study due to limited resources,technical challenges and ethics.Moreover,the precise regulatory mechanism underlying early human embryonic development remains unknown.In recent years,the emergence of stem cell-based embryo models(SCBEM)provides the opportunity to reconstitute pre-to post-implantation development in vitro.These models to some extent mimic the embryo morphologically and transcriptionally,and thus may be used to study key events in mammalian pre-and post-implantation development.Many groups have successfully generated SCBEM of the mouse and human.Here,we provide a comparative review of the mouse and human SCBEM,discuss the capability of these models to mimic natural embryos and give a perspective on their potential future applications.
基金This review was supported by the National Natural Science Foundation of China(Grant No.81960292 to C.C.)the Qinghai Provincial Department of Science and Technology(Grant No.2022-ZJ-951Q to C.C.)Qinghai Province“Kunlun Talents,High-end Innovative and Entrepreneurial Talents”Project to C.C.We apologize to investigators whose contributions were not cited due to space limitations.
文摘Ubiquitination is a highly conserved and fundamental posttranslational modification(PTM)in all eukaryotes regulating thousands of proteins.The RING(really interesting new gene)finger(RNF)protein,containing the RING domain,exerts E3 ubiquitin ligase that mediates the covalent attachment of ubiquitin(Ub)to target proteins.Multiple reviews have summarized the critical roles of the tripartite-motif(TRIM)protein family,a subgroup of RNF proteins,in various diseases,including cancer,inflammatory,infectious,and neuropsychiatric disorders.Except for TRIMs,since numerous studies over the past decades have delineated that other RNF proteins also exert widespread involvement in several diseases,their importance should not be underestimated.This review summarizes the potential contribution of dysregulated RNF proteins,except for TRIMs,to the pathogenesis of some diseases,including cancer,autoimmune diseases,and neurodegenerative disorder.Since viral infection is broadly involved in the induction and development of those diseases,this manuscript also highlights the regulatory roles of RNF proteins,excluding TRIMs,in the antiviral immune responses.In addition,we further discuss the potential intervention strategies targeting other RNF proteins for the prevention and therapeutics of those human diseases.
基金supported by the National Natural Science Foundation of China(32060176)the National Key Research and Development Program of China(2022YFD1302202,2022YFD1302203)+4 种基金the Program for Young Talents of Science and Technology in Universities of Inner Mongolia Autonomous Region(NJYT23091)the Program of Higher-Level Talents of Inner Mongolia University(10000-21311201/058)the Inner Mongolia Autonomous Region Natural Science Foundation(2021MS03003)the Inner Mongolia Autonomous Region Science and Technology Plan of China(2020ZD0007,2020ZD0008)the Inner Mongolia Engineering Technology Research Centre of Germplasm Resources Conservation and Utilization(21400-222526)。
文摘Dear Editor,Embryonic stem cells(ESCs)and trophoblast stem cells(TSCs)are derived from blastocysts(Lu et al.,2001).Blastocyst-like structures(blastoids)are self-assembled structures formed by a combination of ESCs and TSCs(Rivron et al.,2018).To increase the success rate of blastoid formation and its similarity with the features of blastocysts,some reports showed that blastoid could also be derived from a combination of three cell lines,ESCs,TSCs,and extraembryonic endoderm cells(XENs),or novel type of stem cells(Sozen et al.,2018;Weatherbee et al.,2023:Wu et al.,2023;Zhang et al.,2023;Zhang et al.,2019).