AIM:To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia,located in the northwest part of China.METHODS:A stratified,randomized sampling procedure was...AIM:To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia,located in the northwest part of China.METHODS:A stratified,randomized sampling procedure was employed in the study,including urban and rural area of all age group.Visual acuity,anterior segment and ocular fundus were checked.Related factor of corneal disease,including age,gender,education status,ethnic group,location and occupation,were identified according to uniform customized protocol.An eye was defined to be corneal blindness if the visual acuity was【20/400 due to a corneal disease.RESULTS:Three thousand individuals(1290 from urban area and 1710 from rural area)participated in the investigation,with a response rate of 80.380%.The prevalence of corneal blindness was 0.023%in both eyes and 0.733%in at least one eye.The blindness in at least one eye with varied causes was present in 106participants(3.533%)and in bilateral eyes in 34participants(1.133%).The corneal diseases accounted for 20.754%of blindness in at least one eye and 20.588%of bilateral blindness.The prevalence of corneal disease was higher in older and Han ethnic group,especially those who occupied in agriculture and outdoor work.People with corneal blindness were more likely to be older and lower education.Rural population were more likely to suffer from bilateral corneal blindness than the urban population in≥59-year group(χ2=6.716,P=0.019).Infectious,trauma and immune corneal disease were the three leading causes of corneal disease.Trauma cornealdisease was more likely leading to blindness in one eye.However,infectious and immune corneal diseases make more contribution to the bilateral corneal blindness.CONCLUSION:Corneal blindness is a significant burden of in Ningxia population,encompassing a variety of corneal infections and trauma;the majority of those were avoidable.Health promotion strategies and good hygienic conditions have to be developed.展开更多
AIM:To analyze the pathogenicity and clinical features of patients in a consanguineous cone-rod dystrophy(CRD)family due to heterozygous variants in the GUCY2D gene.METHODS:Whole exome sequencing was used to screen fo...AIM:To analyze the pathogenicity and clinical features of patients in a consanguineous cone-rod dystrophy(CRD)family due to heterozygous variants in the GUCY2D gene.METHODS:Whole exome sequencing was used to screen for pathogenic genes and candidate pathogenic variants were obtained by bioinformatics analysis.Sanger sequencing was used for validation and familial cosegregation analysis to determine pathogenic variants.Pymol software was applied to produce a 3D structure image of the protein to analyze the structural and functional alterations of the protein.The pathogenicity of genetic variants was evaluated according to ACMG guidelines.RESULTS:The chief clinical symptoms of this proband included obvious visual impairment,protanopia and deuteranopia,peripheral punctate pigment,arteriolar attenuation,structural and functional abnormalities revealed by optical coherence tomography(OCT)and electroretinography(ERG)including thinning of the outer retinal layer,a discontinuous external limiting membrane(ELM)and ellipsoid zone(EZ),granular hyperreflective projections between the retinal pigment epithelium and the interdigitation zone,severe attenuation of photopic responses with mild reduced scotopic responses.Wholeexome sequencing revealed that the proband carried a heterozygous variant of the GUCY2D gene:c.2512C>T:p.Arg838Cys.Three-dimensional molecular structure analysis of the protein revealed that amino acid 838 was mutated from polar positively charged arginine to polar uncharged cysteine,and the spatial structure of the protein changed greatly.Sanger sequencing co-segregation analysis confirmed that such a variant was detected in neither the phenotypically normal parents nor the daughter of the proband,which was presumed to be a de novo one.The variant was determined to be pathogenic according to ACMG guidelines.The heterozygous variant at the same site was detected in the abnormal proband’s son with moderate attenuation of photopic electroretinographic responses and normal scotopic electroretinographic responses,supporting autosomal dominant inheritance.CONCLUSION:The de novo variant causing atypical autosomal dominant CRD is identified in a Chinese consanguineous family and this variant passes through this family in an autosomal dominant mode of inheritance,revealing the complex diversity and unpredictability of the inheritance mode for common single-gene genetic disease.展开更多
AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy fam...AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy family members were included in this study.All participants received routine ophthalmic examinations.The target next-generation sequencing(NGS)was performed to determine the causative mutation for this family.The silico analysis was also applied to predict the pathogenesis of identified mutations.RESULTS:All patients had severe ptosis,normal intelligence,female patients have normal fertility.Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene,c.672_701 ins GCGGCTGCCGC CGCAGCTGCTG CAGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA),carried by 13 patient but absent in all unaffected members.In silico analysis supported the pathogenic nature of this highly conserved variant.This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain,which increased the number of original polyalanine chains from 14 to 24,resulting in an extended protein.CONCLUSION:A novel FOXL2 mutation c.672_701 ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA)was identified in a large Chinese family with BPES.This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotypecorrelations,which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.展开更多
AIM：To describe the clinical characteristics with genetic lesions in a Chinese family with Crouzon syndrome. METHODS： All five patients from this family were included and received comprehensive ophthalmic and system...AIM：To describe the clinical characteristics with genetic lesions in a Chinese family with Crouzon syndrome. METHODS： All five patients from this family were included and received comprehensive ophthalmic and systemic examinations.Direct sequencing of the FGFR2 gene was employed for mutation identification.Crystal structure analysis was applied to analyze the structural changes associated with the substitution. RESULTS： All patients presented typical Crouzon features,including short stature,craniosynostosis,mandibular prognathism,shallow orbits with proptosis,and exotropia.Intrafamilial phenotypic diversities were observed.Atrophic optic nerves were exclusively detected in the proband and her son.Cranial magnetic resonance imaging implied a cystic lesion in her sellar and third ventricular regions.A missense mutation,FGFR2 p.Cys342 Trp,was found as disease causative.This substitution would generate conformational changes in the extracellular Ig-III domain of the FGFR-2 protein,thus altering its physical and biological properties.CONCLUSION： We describe the clinical presentations and genotypic lesions in a Chinese family with Crouzon syndrome.The intrafamilial phenotypic varieties in this family suggest that other genetic modifiers may also play a role in the pathogenesis of Crouzon syndrome.展开更多
AIM：To identify the expression of lens-related micro RNAs（miRNAs）in the central epithelium of transparent infant lenses and congenital cataract. METHODS：Lens-related mi RNAs were retrieved from Pub Med database. T...AIM：To identify the expression of lens-related micro RNAs（miRNAs）in the central epithelium of transparent infant lenses and congenital cataract. METHODS：Lens-related mi RNAs were retrieved from Pub Med database. The expression levels of these mi RNAs in transparent infant lenses and congenital cataract were determined by stem-loop reverse transcription-polymerase chain reaction（RT-PCR）. mi Randa algorithm was used to predict the target genes of these differentially expressed mi RNAs. The target m RNA was validated.RESULTS：Six lens-related mi RNAs were retrieved from screening Pub Med database. The most abundant mi RNA in transparent infant lenses according to stem-loop RT-PCR was mi R-184. miR-182 was up-regulated in congenital cataract. Contrarily,miR-204 and miR-124 was down-regulated.mi R-204 exhibited a more significant decrease in expression than mi R-124. In addition,Meis2 was predicted to be the target of mi R-204 using mi Randa algorithm. mi R-204mimic/antagomir transfection experiments suggested the negative correlation between the expression of mi R-204 and Meis2.CONCLUSION：The expression levels of miR-182,miR-204 and mi R-124 differ between the central epithelium of transparent infant lens and congenital cataract,suggesting their involvement in the pathogenesis of congenital cataract. miR-204 may act via silencing Meis2 to regulate lens development and congenital cataract formation.展开更多
AIM:To screen mutations in the retinitis pigmentosa 1(RP1) gene and the rhodopsin(RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento(RPSP)and describe the genotype-phenotype relationship of the muta...AIM:To screen mutations in the retinitis pigmentosa 1(RP1) gene and the rhodopsin(RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento(RPSP)and describe the genotype-phenotype relationship of the mutations.·METHODS:Twenty affected,unrelated Chinese individuals with RPSP(4 autosomal dominant RPSP,12autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012.The clinical features were determined by complete ophthalmologic examinations.Polymerase chain reaction(PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1gene and the RHO gene.The cosegregation analysis and population frequency studies were performed for patients with identified mutations.·RESULTS:Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands.Four missense changes(rs444772,rs446227,rs414352,rs441800) and one non-coding variant(rs56340615) were common SNPs and none of them showed a significant relationship with RPSP.A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family,suggestive of pathogenic.In addition,population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.·CONCLUSION:The identification of p.R1443W mutationcosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation,while RHO gene is not associated with the pathogenesis of RPSP in this study.To our knowledge,this is the fist mutation identified to associate with RPSP.展开更多
AIM： To investigate the association between IL-10-producing regulatory B（B10） cells and the clinical features of thyroid-associated orbitopathy（TAO）. METHODS： A total of 30 patients with TAO were recruited at Zh...AIM： To investigate the association between IL-10-producing regulatory B（B10） cells and the clinical features of thyroid-associated orbitopathy（TAO）. METHODS： A total of 30 patients with TAO were recruited at Zhongshan Ophthalmic Center from May 2015 to December 2015. Peripheral blood mononuclear cells（PBMCs） were separated from blood samples of 30 TAO patients and 16 healthy controls and stimulated with CD40 ligand and CpG for 48h. The frequency of IL-10＋ B cells was examined by flow cytometry and the correlation between the frequency of IL-10＋ B cells and clinical features of TAO was analyzed by SPSS. RESULTS： The frequency of IL-10＋ B cells among CD19＋ B cells in TAO patients was significantly lower than in healthy controls（TAO： 4.66%±1.88% vs healthy control： 6.82%±2.40%, P〈0.01）. The frequency of IL-10＋ B cells showed a positive correlation with disease activity of TAO measured by Clinical Activity Score（CAS）（r=0.50, P〈0.01）, and became higher in TAO patients with family history of Graves＇ disease（GD）（P=0.04）. CONCLUSION： The decrease of the frequency of IL-10＋ B cells in TAO patients indicates the deficiency of B10 cells in TAO, and the positive association with disease activity suggests its important role in TAO inflammation regulation.展开更多
AIM:To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32.METHODS:A family with familial exudative vitreoretinopathy(FEVR)phenotype was i...AIM:To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32.METHODS:A family with familial exudative vitreoretinopathy(FEVR)phenotype was included in the study.Whole-exome sequencing(WES)was initially used to locate copy number variations(CNVs)on 7q31.31-31.32,but failed to detect the precise breakpoint.The long-read sequencing,Oxford Nanopore sequencing Technology(ONT)was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction(QPCR)and Sanger Sequencing.RESULTS:The proband,along with her father and younger brother,were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32,which included the FEVRrelated gene TSPAN12.The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del.The proband exhibited a phase 2A FEVR phenotype,characterized by a falciform retinal fold,macular dragging,and peripheral neovascularization with leaking of fluorescence.These symptoms led to a significant decrease in visual acuity in both eyes.On the other hand,the affected father and younger brother showed a milder phenotype.CONCLUSION:The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype.The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders.展开更多
AIM: To investigate whether the gene variants in MYOC and ABCA1 are associated with primary angle-closure glaucoma(PACG) and anterior chamber depth(ACD) and axial length(AL) in samples from northern China. METHODS: Th...AIM: To investigate whether the gene variants in MYOC and ABCA1 are associated with primary angle-closure glaucoma(PACG) and anterior chamber depth(ACD) and axial length(AL) in samples from northern China. METHODS: The present case-control association study consisted of 500 PACG patients and 720 unrelated controls. Each participant was genotyped for eleven single nucleotide polymorphisms(SNPs) in MYOC and ABCA1 genes(rs12076134, rs183532, rs235875 and rs235913 in MYOC, rs2422493, rs2487042, rs2472496, rs2472493, rs2487032, rs2472459 and rs2472519 near ABCA1) using an improved multiplex ligation detection reaction(iMLDR) technique. The genetic association analyses were performed by PLINK using a logistic regression model. The association between genotypes and ocular biometric parameters was performed by SPSS using generalized estimation equation. Bonferroni corrections wereimplemented and the statistical power was calculated by the Power and Sample Size Calculation. RESULTS: Two SNPs rs183532 and rs235875 as well as a haplotype TTC in MYOC were nominally associated with PACG despite the significance was lost after Bonferroni correction. No association was observed between ABCA1 and PACG, neither did the association between these variants and ACD as well as AL. CONCLUSION: The present study suggests MYOC and ABCA1 do not play a part in the pathogenesis of PACG as well as the regulation of ocular biometric parameters in a northern Chinese population. Further investigations with large sample size are needed to verify this consequence.展开更多
AIM: To identify mutations with whole exome sequencing(WES) in a Chinese X-linked retinitis pigmentosa(XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from p...AIM: To identify mutations with whole exome sequencing(WES) in a Chinese X-linked retinitis pigmentosa(XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to Sure Select Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiS eq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation.RESULTS: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29113 del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp(D10 Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa(RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP.CONCLUSION: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.展开更多
Cavernous hemangioma is the most primary benign orbital tumor in adults,and majority of cases could be easily settled by surgical treatment.However,cavernous hemangioma lodged deep in the orbital apex remained a chall...Cavernous hemangioma is the most primary benign orbital tumor in adults,and majority of cases could be easily settled by surgical treatment.However,cavernous hemangioma lodged deep in the orbital apex remained a challenge because the surgery may pose a high risk of injury to the optic nerve and significant visual loss.This presentation would report a case of cavernous hemangioma located in orbital apex who presented superonasal and inferotemporal peripheral vision defect.The patient received fully transnasal endoscopic surgery,and a 2 cm×1.5 cm tumor was successfully removed from the left orbital apex.The treatment results were satisfactory,with no after-effects and adverse reactions during follow-up.This case highlighted that transnasal endoscopic surgery is a promising technique for cavernous hemangiomas that are located deep in orbital apex.This approach provides direct pathway to tumor with limiting morbidity,maximal surgical field and ample illumination.The procedure represents a safe and less invasive management.展开更多
In ophthalmology,the quality of fundus images is critical for accurate diagnosis,both in clinical practice and in artificial intelligence(AI)-assisted diagnostics.Despite the broad view provided by ultrawide-field(UWF...In ophthalmology,the quality of fundus images is critical for accurate diagnosis,both in clinical practice and in artificial intelligence(AI)-assisted diagnostics.Despite the broad view provided by ultrawide-field(UWF)imaging,pseudocolor images may conceal critical lesions necessary for precise diagnosis.To address this,we introduce UWF-Net,a sophisticated image enhancement algorithm that takes disease characteristics into consideration.Using the Fudan University ultra-wide-field image(FDUWI)dataset,which includes 11294 Optos pseudocolor and 2415 Zeiss true-color UWF images,each of which is rigorously annotated,UWF-Net combines global style modeling with feature-level lesion enhancement.Pathological consistency loss is also applied to maintain fundus feature integrity,significantly improving image quality.Quantitative and qualitative evaluations demonstrated that UWF-Net outperforms existing methods such as contrast limited adaptive histogram equalization(CLAHE)and structure and illumination constrained generative adversarial network(StillGAN),delivering superior retinal image quality,higher quality scores,and preserved feature details after enhancement.In disease classification tasks,images enhanced by UWF-Net showed notable improvements when processed with existing classification systems over those enhanced by StillGAN,demonstrating a 4.62%increase in sensitivity(SEN)and a 3.97%increase in accuracy(ACC).In a multicenter clinical setting,UWF-Net-enhanced images were preferred by ophthalmologic technicians and doctors,and yielded a significant reduction in diagnostic time((13.17±8.40)s for UWF-Net enhanced images vs(19.54±12.40)s for original images)and an increase in diagnostic accuracy(87.71%for UWF-Net enhanced images vs 80.40%for original images).Our research verifies that UWF-Net markedly improves the quality of UWF imaging,facilitating better clinical outcomes and more reliable AI-assisted disease classification.The clinical integration of UWF-Net holds great promise for enhancing diagnostic processes and patient care in ophthalmology.展开更多
Vision health is crucial for overall well-being,affecting physical health,livelihoods,and social sustainability.Visual impairment limits mobility,increases risks of dementia,falls,and accidents,and burdens social care...Vision health is crucial for overall well-being,affecting physical health,livelihoods,and social sustainability.Visual impairment limits mobility,increases risks of dementia,falls,and accidents,and burdens social care systems[1].The International Agency for the Prevention of Blindness(IAPB)reported that in 2020,1.1 billion people worldwide were visually impaired,including 43 million with blindness and 295 million with moderate to severe visual impairment[2].This burden is unevenly distributed,with low-and middle-income countries/regions bearing the brunt.Visual health is essential for good health and well-being,and promoting eye health is a key topic for social development guided by the United Nations Sustainable Development Goals(SDGs).Despite significant progress in preventing and treating blindness,China now faces a shift in its main eye health challenge from infectious to non-infectious eye diseases due to an aging population and persistent unhealthy lifestyles.展开更多
基金Supported by Consultation Program of Chinese Academy of Engineering(No.2009-77)Research Program of Ningxia Science and Technology Department(No.NKJ2010-168)
文摘AIM:To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia,located in the northwest part of China.METHODS:A stratified,randomized sampling procedure was employed in the study,including urban and rural area of all age group.Visual acuity,anterior segment and ocular fundus were checked.Related factor of corneal disease,including age,gender,education status,ethnic group,location and occupation,were identified according to uniform customized protocol.An eye was defined to be corneal blindness if the visual acuity was【20/400 due to a corneal disease.RESULTS:Three thousand individuals(1290 from urban area and 1710 from rural area)participated in the investigation,with a response rate of 80.380%.The prevalence of corneal blindness was 0.023%in both eyes and 0.733%in at least one eye.The blindness in at least one eye with varied causes was present in 106participants(3.533%)and in bilateral eyes in 34participants(1.133%).The corneal diseases accounted for 20.754%of blindness in at least one eye and 20.588%of bilateral blindness.The prevalence of corneal disease was higher in older and Han ethnic group,especially those who occupied in agriculture and outdoor work.People with corneal blindness were more likely to be older and lower education.Rural population were more likely to suffer from bilateral corneal blindness than the urban population in≥59-year group(χ2=6.716,P=0.019).Infectious,trauma and immune corneal disease were the three leading causes of corneal disease.Trauma cornealdisease was more likely leading to blindness in one eye.However,infectious and immune corneal diseases make more contribution to the bilateral corneal blindness.CONCLUSION:Corneal blindness is a significant burden of in Ningxia population,encompassing a variety of corneal infections and trauma;the majority of those were avoidable.Health promotion strategies and good hygienic conditions have to be developed.
基金Supported by the National Natural Science Foundation of China(No.82260206)Natural Science Foundation of Ningxia(No.2022AAC03387)+1 种基金Major Achievement Transformation Project of Ningxia Hui Autonomous Region(No.2022CJE09011)the Key Research Development Project of Ningxia Hui Autonomous Region(No.2024BEG02017).
文摘AIM:To analyze the pathogenicity and clinical features of patients in a consanguineous cone-rod dystrophy(CRD)family due to heterozygous variants in the GUCY2D gene.METHODS:Whole exome sequencing was used to screen for pathogenic genes and candidate pathogenic variants were obtained by bioinformatics analysis.Sanger sequencing was used for validation and familial cosegregation analysis to determine pathogenic variants.Pymol software was applied to produce a 3D structure image of the protein to analyze the structural and functional alterations of the protein.The pathogenicity of genetic variants was evaluated according to ACMG guidelines.RESULTS:The chief clinical symptoms of this proband included obvious visual impairment,protanopia and deuteranopia,peripheral punctate pigment,arteriolar attenuation,structural and functional abnormalities revealed by optical coherence tomography(OCT)and electroretinography(ERG)including thinning of the outer retinal layer,a discontinuous external limiting membrane(ELM)and ellipsoid zone(EZ),granular hyperreflective projections between the retinal pigment epithelium and the interdigitation zone,severe attenuation of photopic responses with mild reduced scotopic responses.Wholeexome sequencing revealed that the proband carried a heterozygous variant of the GUCY2D gene:c.2512C>T:p.Arg838Cys.Three-dimensional molecular structure analysis of the protein revealed that amino acid 838 was mutated from polar positively charged arginine to polar uncharged cysteine,and the spatial structure of the protein changed greatly.Sanger sequencing co-segregation analysis confirmed that such a variant was detected in neither the phenotypically normal parents nor the daughter of the proband,which was presumed to be a de novo one.The variant was determined to be pathogenic according to ACMG guidelines.The heterozygous variant at the same site was detected in the abnormal proband’s son with moderate attenuation of photopic electroretinographic responses and normal scotopic electroretinographic responses,supporting autosomal dominant inheritance.CONCLUSION:The de novo variant causing atypical autosomal dominant CRD is identified in a Chinese consanguineous family and this variant passes through this family in an autosomal dominant mode of inheritance,revealing the complex diversity and unpredictability of the inheritance mode for common single-gene genetic disease.
文摘AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy family members were included in this study.All participants received routine ophthalmic examinations.The target next-generation sequencing(NGS)was performed to determine the causative mutation for this family.The silico analysis was also applied to predict the pathogenesis of identified mutations.RESULTS:All patients had severe ptosis,normal intelligence,female patients have normal fertility.Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene,c.672_701 ins GCGGCTGCCGC CGCAGCTGCTG CAGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA),carried by 13 patient but absent in all unaffected members.In silico analysis supported the pathogenic nature of this highly conserved variant.This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain,which increased the number of original polyalanine chains from 14 to 24,resulting in an extended protein.CONCLUSION:A novel FOXL2 mutation c.672_701 ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA)was identified in a large Chinese family with BPES.This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotypecorrelations,which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.
基金Supported by National Key Basic Research Program of China(No.2013CB967500)National Natural Science Foundation of China(No.81525006+4 种基金No.81670864No.81260154No.81460093)Jiangsu Province's Innovation TeamA Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions(PAPD)
文摘AIM：To describe the clinical characteristics with genetic lesions in a Chinese family with Crouzon syndrome. METHODS： All five patients from this family were included and received comprehensive ophthalmic and systemic examinations.Direct sequencing of the FGFR2 gene was employed for mutation identification.Crystal structure analysis was applied to analyze the structural changes associated with the substitution. RESULTS： All patients presented typical Crouzon features,including short stature,craniosynostosis,mandibular prognathism,shallow orbits with proptosis,and exotropia.Intrafamilial phenotypic diversities were observed.Atrophic optic nerves were exclusively detected in the proband and her son.Cranial magnetic resonance imaging implied a cystic lesion in her sellar and third ventricular regions.A missense mutation,FGFR2 p.Cys342 Trp,was found as disease causative.This substitution would generate conformational changes in the extracellular Ig-III domain of the FGFR-2 protein,thus altering its physical and biological properties.CONCLUSION： We describe the clinical presentations and genotypic lesions in a Chinese family with Crouzon syndrome.The intrafamilial phenotypic varieties in this family suggest that other genetic modifiers may also play a role in the pathogenesis of Crouzon syndrome.
基金Supported by the Natural Science Foundation of China(No.81470614)the Fundamental Research Funds for the Central Universities sponsored by Xi’an Jiaotong University(No.xjj2013067)+1 种基金Youth Foundation of the First Affiliated Hospital,Medical College,Xi’an Jiaotong University(No.2014YK7)Scientific Research Funds for the Health and Family Planning of Shaanxi Province(No.2016D068)
文摘AIM：To identify the expression of lens-related micro RNAs（miRNAs）in the central epithelium of transparent infant lenses and congenital cataract. METHODS：Lens-related mi RNAs were retrieved from Pub Med database. The expression levels of these mi RNAs in transparent infant lenses and congenital cataract were determined by stem-loop reverse transcription-polymerase chain reaction（RT-PCR）. mi Randa algorithm was used to predict the target genes of these differentially expressed mi RNAs. The target m RNA was validated.RESULTS：Six lens-related mi RNAs were retrieved from screening Pub Med database. The most abundant mi RNA in transparent infant lenses according to stem-loop RT-PCR was mi R-184. miR-182 was up-regulated in congenital cataract. Contrarily,miR-204 and miR-124 was down-regulated.mi R-204 exhibited a more significant decrease in expression than mi R-124. In addition,Meis2 was predicted to be the target of mi R-204 using mi Randa algorithm. mi R-204mimic/antagomir transfection experiments suggested the negative correlation between the expression of mi R-204 and Meis2.CONCLUSION：The expression levels of miR-182,miR-204 and mi R-124 differ between the central epithelium of transparent infant lens and congenital cataract,suggesting their involvement in the pathogenesis of congenital cataract. miR-204 may act via silencing Meis2 to regulate lens development and congenital cataract formation.
基金Ningxia Scientific and Technological Projects from Department of Science and Technology in Ningxia Hui Autonomous Region (No.2011ZYS175)
文摘AIM:To screen mutations in the retinitis pigmentosa 1(RP1) gene and the rhodopsin(RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento(RPSP)and describe the genotype-phenotype relationship of the mutations.·METHODS:Twenty affected,unrelated Chinese individuals with RPSP(4 autosomal dominant RPSP,12autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012.The clinical features were determined by complete ophthalmologic examinations.Polymerase chain reaction(PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1gene and the RHO gene.The cosegregation analysis and population frequency studies were performed for patients with identified mutations.·RESULTS:Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands.Four missense changes(rs444772,rs446227,rs414352,rs441800) and one non-coding variant(rs56340615) were common SNPs and none of them showed a significant relationship with RPSP.A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family,suggestive of pathogenic.In addition,population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.·CONCLUSION:The identification of p.R1443W mutationcosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation,while RHO gene is not associated with the pathogenesis of RPSP in this study.To our knowledge,this is the fist mutation identified to associate with RPSP.
基金Supported by the National Natural Science Foundation of China(No.81470664No.81670887No.81700875)
文摘AIM： To investigate the association between IL-10-producing regulatory B（B10） cells and the clinical features of thyroid-associated orbitopathy（TAO）. METHODS： A total of 30 patients with TAO were recruited at Zhongshan Ophthalmic Center from May 2015 to December 2015. Peripheral blood mononuclear cells（PBMCs） were separated from blood samples of 30 TAO patients and 16 healthy controls and stimulated with CD40 ligand and CpG for 48h. The frequency of IL-10＋ B cells was examined by flow cytometry and the correlation between the frequency of IL-10＋ B cells and clinical features of TAO was analyzed by SPSS. RESULTS： The frequency of IL-10＋ B cells among CD19＋ B cells in TAO patients was significantly lower than in healthy controls（TAO： 4.66%±1.88% vs healthy control： 6.82%±2.40%, P〈0.01）. The frequency of IL-10＋ B cells showed a positive correlation with disease activity of TAO measured by Clinical Activity Score（CAS）（r=0.50, P〈0.01）, and became higher in TAO patients with family history of Graves＇ disease（GD）（P=0.04）. CONCLUSION： The decrease of the frequency of IL-10＋ B cells in TAO patients indicates the deficiency of B10 cells in TAO, and the positive association with disease activity suggests its important role in TAO inflammation regulation.
基金Supported by the National Natural Science Foundation of China(No.82060183)Ningxia Natural Science Foundation(No.2022AAC03388)the Key Research and Development Project of Ningxia Hui Autonomous Region(No.2021BEG02045,No.2020BEG03044).
文摘AIM:To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32.METHODS:A family with familial exudative vitreoretinopathy(FEVR)phenotype was included in the study.Whole-exome sequencing(WES)was initially used to locate copy number variations(CNVs)on 7q31.31-31.32,but failed to detect the precise breakpoint.The long-read sequencing,Oxford Nanopore sequencing Technology(ONT)was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction(QPCR)and Sanger Sequencing.RESULTS:The proband,along with her father and younger brother,were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32,which included the FEVRrelated gene TSPAN12.The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del.The proband exhibited a phase 2A FEVR phenotype,characterized by a falciform retinal fold,macular dragging,and peripheral neovascularization with leaking of fluorescence.These symptoms led to a significant decrease in visual acuity in both eyes.On the other hand,the affected father and younger brother showed a milder phenotype.CONCLUSION:The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype.The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders.
基金Supported by the National Natural Science Foundation of China(No.81460093)the Ningxia Nature Science Funding from the Department of Science and Technology of Ningxia Hui Autonomous Region(No.NZ16194)
文摘AIM: To investigate whether the gene variants in MYOC and ABCA1 are associated with primary angle-closure glaucoma(PACG) and anterior chamber depth(ACD) and axial length(AL) in samples from northern China. METHODS: The present case-control association study consisted of 500 PACG patients and 720 unrelated controls. Each participant was genotyped for eleven single nucleotide polymorphisms(SNPs) in MYOC and ABCA1 genes(rs12076134, rs183532, rs235875 and rs235913 in MYOC, rs2422493, rs2487042, rs2472496, rs2472493, rs2487032, rs2472459 and rs2472519 near ABCA1) using an improved multiplex ligation detection reaction(iMLDR) technique. The genetic association analyses were performed by PLINK using a logistic regression model. The association between genotypes and ocular biometric parameters was performed by SPSS using generalized estimation equation. Bonferroni corrections wereimplemented and the statistical power was calculated by the Power and Sample Size Calculation. RESULTS: Two SNPs rs183532 and rs235875 as well as a haplotype TTC in MYOC were nominally associated with PACG despite the significance was lost after Bonferroni correction. No association was observed between ABCA1 and PACG, neither did the association between these variants and ACD as well as AL. CONCLUSION: The present study suggests MYOC and ABCA1 do not play a part in the pathogenesis of PACG as well as the regulation of ocular biometric parameters in a northern Chinese population. Further investigations with large sample size are needed to verify this consequence.
基金Supported by National Nature Science Foundation of China (No.81760180)Key Research and Development of Ningxia (No.2017BY086)+1 种基金Nature Science Foundation of Ningxia (No.2019AAC03160)Key Research and Development Program of Ningxia (No.2018BEG03051)。
文摘AIM: To identify mutations with whole exome sequencing(WES) in a Chinese X-linked retinitis pigmentosa(XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to Sure Select Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiS eq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation.RESULTS: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29113 del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp(D10 Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa(RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP.CONCLUSION: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.
基金This work was supported by the National Natural Science Foundation of China(81960184)Ningxia Key Research and Development Program(Special Talents)(2018beb04023)Ningxia Key Research and Development Program(General Subject)(2018YBZD1445).
文摘Cavernous hemangioma is the most primary benign orbital tumor in adults,and majority of cases could be easily settled by surgical treatment.However,cavernous hemangioma lodged deep in the orbital apex remained a challenge because the surgery may pose a high risk of injury to the optic nerve and significant visual loss.This presentation would report a case of cavernous hemangioma located in orbital apex who presented superonasal and inferotemporal peripheral vision defect.The patient received fully transnasal endoscopic surgery,and a 2 cm×1.5 cm tumor was successfully removed from the left orbital apex.The treatment results were satisfactory,with no after-effects and adverse reactions during follow-up.This case highlighted that transnasal endoscopic surgery is a promising technique for cavernous hemangiomas that are located deep in orbital apex.This approach provides direct pathway to tumor with limiting morbidity,maximal surgical field and ample illumination.The procedure represents a safe and less invasive management.
基金supported by the National Natural Science Foundation of China(82020108006 and 81730025 to Chen Zhao,U2001209 to Bo Yan)the Excellent Academic Leaders of Shanghai(18XD1401000 to Chen Zhao)the Natural Science Foundation of Shanghai,China(21ZR1406600 to Weimin Tan).
文摘In ophthalmology,the quality of fundus images is critical for accurate diagnosis,both in clinical practice and in artificial intelligence(AI)-assisted diagnostics.Despite the broad view provided by ultrawide-field(UWF)imaging,pseudocolor images may conceal critical lesions necessary for precise diagnosis.To address this,we introduce UWF-Net,a sophisticated image enhancement algorithm that takes disease characteristics into consideration.Using the Fudan University ultra-wide-field image(FDUWI)dataset,which includes 11294 Optos pseudocolor and 2415 Zeiss true-color UWF images,each of which is rigorously annotated,UWF-Net combines global style modeling with feature-level lesion enhancement.Pathological consistency loss is also applied to maintain fundus feature integrity,significantly improving image quality.Quantitative and qualitative evaluations demonstrated that UWF-Net outperforms existing methods such as contrast limited adaptive histogram equalization(CLAHE)and structure and illumination constrained generative adversarial network(StillGAN),delivering superior retinal image quality,higher quality scores,and preserved feature details after enhancement.In disease classification tasks,images enhanced by UWF-Net showed notable improvements when processed with existing classification systems over those enhanced by StillGAN,demonstrating a 4.62%increase in sensitivity(SEN)and a 3.97%increase in accuracy(ACC).In a multicenter clinical setting,UWF-Net-enhanced images were preferred by ophthalmologic technicians and doctors,and yielded a significant reduction in diagnostic time((13.17±8.40)s for UWF-Net enhanced images vs(19.54±12.40)s for original images)and an increase in diagnostic accuracy(87.71%for UWF-Net enhanced images vs 80.40%for original images).Our research verifies that UWF-Net markedly improves the quality of UWF imaging,facilitating better clinical outcomes and more reliable AI-assisted disease classification.The clinical integration of UWF-Net holds great promise for enhancing diagnostic processes and patient care in ophthalmology.
基金supported by the National Natural Science Foundation of China(82330031).
文摘Vision health is crucial for overall well-being,affecting physical health,livelihoods,and social sustainability.Visual impairment limits mobility,increases risks of dementia,falls,and accidents,and burdens social care systems[1].The International Agency for the Prevention of Blindness(IAPB)reported that in 2020,1.1 billion people worldwide were visually impaired,including 43 million with blindness and 295 million with moderate to severe visual impairment[2].This burden is unevenly distributed,with low-and middle-income countries/regions bearing the brunt.Visual health is essential for good health and well-being,and promoting eye health is a key topic for social development guided by the United Nations Sustainable Development Goals(SDGs).Despite significant progress in preventing and treating blindness,China now faces a shift in its main eye health challenge from infectious to non-infectious eye diseases due to an aging population and persistent unhealthy lifestyles.
