Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
The research presented in this paper aimed to analyze the evolution of fractures in strata in relation to the progress of longwall mining.To achieve this objective,an introscopic probe equipped with a highresolution c...The research presented in this paper aimed to analyze the evolution of fractures in strata in relation to the progress of longwall mining.To achieve this objective,an introscopic probe equipped with a highresolution camera was developed,along with additional equipment that enables continuous recording of the internal surfaces of drainage boreholes exceeding 100 m in depth.The probe was utilized to test two methane drainage boreholes in the Z-3b longwall,which operates within the 501/3 coal seam of the Jankowice mine in Poland.Automatic image analysis methods were applied to evaluate the recorded images,based on a newly developed classificationsystem for fractures categorized by size and number.The results were compared with an analysis of changes in the methane capture rate from the drainage boreholes,which correlated with longwall mining progress.A strong correlation was observed between the number of fractures and the lithology of the strata layers.The largest number of fractures and their evolution were recorded in the coal layers,followed by the shale layers,while the sandstone layers exhibited the least number of fractures.Based on parallel measurements of the methane capture rate from the drainage boreholes during the progress of longwall mining,the extent of the strata's fracture zone was determined to range from 6 m to 36 m.Within the fracture zone,the strata are highly fractured,which leads to an increase in methane emissions through seepage and diffusion processes.展开更多
Schizophrenia(SCZ) is a severe mental disorder with an unclear pathogenesis.Increasing evidence suggests that oxidative stress(OS) may contribute to the neuropathological processes underlying SCZ.Biothiols,key endogen...Schizophrenia(SCZ) is a severe mental disorder with an unclear pathogenesis.Increasing evidence suggests that oxidative stress(OS) may contribute to the neuropathological processes underlying SCZ.Biothiols,key endogenous antioxidants,have been proposed as potential biomarkers for the disease.However,due to the presence of the blood-brain barrier(BBB),fluorescent probes are rarely used to image biothiols in the brain of SCZ models.In this study,a series of fluorescent probes for biothiols were developed using dicyanoisophorone derivatives as fluorophores known for their excellent optical properties,and carboxylic esters as recognition units.A parallel synthesis and rapid screening strategy was employed to construct and optimize these probes.By introducing trifluoromethyl and benzothiazole groups into the fluorophore,the emission wavelength was successfully shifted into the near-infrared region.Additionally,various trifluoromethyl-substituted aromatic and nitrogen heterocyclic compounds were incorporated to optimize the carboxylic esters,thereby improving the probes' reactivity and lipophilicity.Systematic evaluation of the physicochemical characteristics,and optical performance led to the identification of DCIBT-11 as the most promising candidate.DCI-BT-11 demonstrated excellent BBB permeability and a good response to biothiols both in vitro and in vivo.Notably,DCI-BT-11 was used for the first time to visualize biothiol flux and assess the therapeutic effects of the antioxidant N-acetylcysteine(NAC) in the brains of SCZ mouse models,offering new insights into the role of OS in the pathogenesis and treatment of SCZ.展开更多
Ferroptosis has exhibited great potential in therapies and intracellular reducing agents of sulfur species(RSSs) in the thiol-dependent redox systems are crucial in ferroptosis.This makes the simultaneous detection of...Ferroptosis has exhibited great potential in therapies and intracellular reducing agents of sulfur species(RSSs) in the thiol-dependent redox systems are crucial in ferroptosis.This makes the simultaneous detection of multiple RSSs significant for evaluating ferroptosis therapy.However,the traditional techniques,including fluorescent(FL) imaging and electrospray ionization-based mass spectrometry(MS) detection,cannot achieve the discrimination of different RSSs.Herein,simultaneous MS detection of multiple RSSs,including cysteine(Cys),homocysteine(Hcy),glutathione(GSH) and hydrogen sulfide(H_(2)S),was obtained upon enhancing ionization efficiency by a fluorescent probe(NBD-O-1).Based on the interaction between NBD-O-1 and RSSs,the complex of RSSs with a fragment of NBD-O-1 can be generated,which can be easily ionized for MS detection in the negative mode.Therefore,the intracellular RSSs can be well detected upon the incubation of He La cells with the probe of NBD-O-1,exhibiting the total RSS levels by the FL imaging and further providing expression of each RSS by enhanced MS detection.Furthermore,the RSSs during ferroptosis in He La cells have been evaluated using the present strategy,demonstrating the potential for ferroptosis examinations.This work has made an unconventional application of a fluorescent probe to enhance the detection of multiple RSSs by MS,providing significant molecular information for addressing the ferroptosis mechanism.展开更多
Fluorescent probes,with their superior optical properties and labeling versatility,have greatly advanced the visualization of intracellular molecules and subcellular structures.However,poor cytoplasmic delivery,caused...Fluorescent probes,with their superior optical properties and labeling versatility,have greatly advanced the visualization of intracellular molecules and subcellular structures.However,poor cytoplasmic delivery,caused by charge,size,or targeting groups,limits the effective use of many fluorescent probes in live cells.Recently,cell-penetrating peptides(CPPs)have emerged as efficient carriers,offering great potential for the cytoplasmic delivery of fluorescent probes in live cells.This review provides a comprehensive overview of CPPs as vehicles for probe delivery,outlining advances in their development,conjugation chemistries,and intracellular delivery mechanisms.Recent applications in live-cell imaging are highlighted and organized according to major CPP modification strategies,including sequence engineering,cyclization,hybrid design and enhancement by chemical reagents.Finally,the challenges that remain and the future outlook of this rapidly evolvingfield are discussed.展开更多
The thoracic duct(TD),the largest lymphatic vessel in the human body,plays a critical role in returning lymph to the circulatory system.However,its dynamic,distensible nature and concealed anatomical location make int...The thoracic duct(TD),the largest lymphatic vessel in the human body,plays a critical role in returning lymph to the circulatory system.However,its dynamic,distensible nature and concealed anatomical location make intraoperative visualization critically challenging and increase the risk of injury.Real-time,high-resolution assessment of TD leaks remains an urgent clinical need.Here,we present a breakthrough molecular engineering strategy that leverages an intestinally lipophilic fluorescent formulation for dynamic in vivo TD imaging.Our rationally designed cyanine derivative IR790+,known for its rapid membrane permeability and endoplasmic reticulum(ER)targeting localization,demonstrates unprecedented chylomicron affinity,which subsequently transports the dye through the lymphatic system to the TD.Notably,dynamic,high-contrast intraoperative TD imaging is achieved from rat models to swine models.Administered orally as near-infrared(NIR)fluorescent contrast agent,this ultra-stable IR790+@oil formulation,engineered via flash nanoprecipitation,surpasses conventional counterparts by enabling non-invasive,real-time identification of TD.Intriguingly,this first-reported ER-targeting NIR formulation,delivered orally,represents a paradigm shift in fluorescence-guided surgery,significantly improving intraoperative accuracy.展开更多
The detection of amino acid enantiomers holds significant importance in biomedical,chemical,food,and other fields.Traditional chiral recognition methods using fluorescent probes primarily rely on fluorescence intensit...The detection of amino acid enantiomers holds significant importance in biomedical,chemical,food,and other fields.Traditional chiral recognition methods using fluorescent probes primarily rely on fluorescence intensity changes,which can compromise accuracy and repeatability.In this study,we report a novel fluorescent probe(R)-Z1 that achieves effective enantioselective recognition of chiral amino acids in water by altering emission wavelengths(>60 nm).This water-soluble probe(R)-Z1 exhibits cyan or yellow-green luminescence upon interaction with amino acid enantiomers,enabling reliable chiral detection of 14 natural amino acids.It also allows for the determination of enantiomeric excess through monitoring changes in luminescent color.Additionally,a logic operation with two inputs and three outputs was constructed based on these optical properties.Notably,amino acid enantiomers were successfully detected via dual-channel analysis at both the food and cellular levels.This study provides a new dynamic luminescence-based tool for the accurate sensing and detection of amino acid enantiomers.展开更多
Sulfur dioxide(SO_(2)) and its derivatives have been recognized as harmful environmental pollutants.However,they are often produced during the processing of traditional Chinese medicines,potentially compromising the q...Sulfur dioxide(SO_(2)) and its derivatives have been recognized as harmful environmental pollutants.However,they are often produced during the processing of traditional Chinese medicines,potentially compromising the quality of these medicinal materials and contributing to various health issues.Due to a lack of effective monitoring and imaging tools,the physiological effects of excessive SO_(2) residues in traditional Chinese medicine remain unclear.Therefore,developing a rapid and effective tool for detecting SO_(2) is crucial for understanding its metabolic pathways and effects in vivo.In this study,we developed a near infrared(NIR) and ratiometric fluorescent probe,NIR-RS,which exhibits high sensitivity,selectivity,and rapid response for SO_(2) detection.Notably,NIR-RS accurately quantifies SO_(2) contents in Pinelliae rhizoma(P.rhizoma) samples,with recovery rates from 98.46 % to 102.40 %,and relative standard deviations(RSDs)< 5.0 %.For bioimaging applications,NIR-RS has low cytotoxicity and good mitochondrial-targeting ability,making it suitable for imaging exogenous and endogenous SO_(2) in mitochondria.Additionally,NIR-RS was successfully applied to image SO_(2) content of P.rhizoma samples within cells,revealing that high SO_(2) residue elevated mitochondria adenosine triphosphate(ATP) content,these findings reveal that P.rhizoma with excessive SO_(2) can affect the organism's growth mechanisms through alterations in ATP pathways.In vivo,SO_(2) was found to predominantly accumulate in the liver following gavage with P.rhizoma solution,with accumulation levels increasing in proportion to SO_(2) residue concentration.High SO_(2) concentrations in P.rhizoma can cause pulmonary fibrosis and gastric mucosal damage.This work provides a valuable tool for regulating SO_(2) content in P.rhizoma and may help researcher better understand the metabolism of SO_(2) derivatives and explore their physiological roles in biological systems.展开更多
The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rear...DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.展开更多
We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to ...We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.展开更多
In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chro...Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.展开更多
In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal a...In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.展开更多
Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric ...Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.展开更多
The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work...The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.展开更多
A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was charact...A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.展开更多
A zinc sulfate open framework matrix,[Zn(SO_4)(DMSO)](1),was synthesized by solvothermal evaporationusing dimethyl sulfoxide(DMSO)as the solvent.A compositeP@1,which exhibits fluorescence and room tempera-ture phospho...A zinc sulfate open framework matrix,[Zn(SO_4)(DMSO)](1),was synthesized by solvothermal evaporationusing dimethyl sulfoxide(DMSO)as the solvent.A compositeP@1,which exhibits fluorescence and room tempera-ture phosphorescence(RTP)properties,was prepared by doping 2,6-naphthalic acid(P)into matrix1at a low con-centration.P@1emitted a green RTP that was visible to the naked eye and lasted for approximately 2 s.P@1exhib-ited selective phosphorescence enhancement response towards Pb^(2+),with a detection limit of 2.52μmol·L^(-1).Themain detection mechanism is the Pb—O coordination-induced phosphorescence enhancement in the system.Inter-estingly,P@1also functioned as a dual-channel probe for the rapid detection of Fe^(3+)ions through fluorescencequenching with a detection limit of 0.038μmol·L^(-1).The recognition mechanism may be attributed to the competi-tive energy absorption betweenP@1and Fe^(3+)ions.CCDC:2388502,1.展开更多
To address the lack of systematic studies on heavy metal fluorescent probes in typical buffer solutions,this study developed a Fe^(3+)and Cu^(2+)fluorescent probe,DHU‑NP‑4,based on a naphthalimide fluorophore.Comparat...To address the lack of systematic studies on heavy metal fluorescent probes in typical buffer solutions,this study developed a Fe^(3+)and Cu^(2+)fluorescent probe,DHU‑NP‑4,based on a naphthalimide fluorophore.Comparative analysis of the probe's performance in various buffer systems revealed that buffers with high organic content are unsuitable for evaluating such probes.Furthermore,the pH of the solvent system was found to significantly influence the probe's behavior.Under highly acidic conditions(pH≤2),DHU‑NP‑4 exhibited exceptional specificity for Fe^(3+),while in alkaline conditions,it demonstrated high specificity for Cu^(2+).Leveraging these properties,the probe enabled the quantitative detection of Fe^(3+)and Cu^(2+)in solution.展开更多
Rheumatoid arthritis(RA) is a chronic inflammatory disease with multi-system damage and autoimmune features.The main clinical manifestations of RA include joint pain,swelling,and stiffness,and RA may lead to joint def...Rheumatoid arthritis(RA) is a chronic inflammatory disease with multi-system damage and autoimmune features.The main clinical manifestations of RA include joint pain,swelling,and stiffness,and RA may lead to joint deformity and dysfunction in severe cases.The pathologic development of RA involves complex interactions of multiple biomarkers,and detecting a single biomarker may produce falsepositive results due to other confounding factors.Therefore,fluorescent probes that can detect multiple biomarkers simultaneously are crucial for precise RA diagnosis.Peroxynitrite(ONOO^(-)) and viscosity are inflammation-related factors in cells.In this study,we developed a dual responsive near-infrared fluorescent probe,YLS,for ONOO^(-) and viscosity.The probe features dual-channel turn-on fluorescence responses at 625 and 760 nm upon the presence of ONOO^(-) and viscosity,respectively.Supported by YLS,we found that during RA pathology,lymphocyte infiltration not only increases the concentration of proteins in the joint fluid resulting in elevated viscosity;at the same time,the overproduction of ONOO^(-) exacerbates oxidative stress and inflammatory responses.This multiparameter assay is expected to improve the diagnostic accuracy of the early stages of RA,thus providing a scientific basis for early intervention and personalized treatment.展开更多
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
基金the PICTO project(RFCR-CT-2018-800711)funded by the European Research Fund for Coal and Steel(RFCS)and the Polish Ministry of Science and Higher Education(W93/FBWiS/2018).
文摘The research presented in this paper aimed to analyze the evolution of fractures in strata in relation to the progress of longwall mining.To achieve this objective,an introscopic probe equipped with a highresolution camera was developed,along with additional equipment that enables continuous recording of the internal surfaces of drainage boreholes exceeding 100 m in depth.The probe was utilized to test two methane drainage boreholes in the Z-3b longwall,which operates within the 501/3 coal seam of the Jankowice mine in Poland.Automatic image analysis methods were applied to evaluate the recorded images,based on a newly developed classificationsystem for fractures categorized by size and number.The results were compared with an analysis of changes in the methane capture rate from the drainage boreholes,which correlated with longwall mining progress.A strong correlation was observed between the number of fractures and the lithology of the strata layers.The largest number of fractures and their evolution were recorded in the coal layers,followed by the shale layers,while the sandstone layers exhibited the least number of fractures.Based on parallel measurements of the methane capture rate from the drainage boreholes during the progress of longwall mining,the extent of the strata's fracture zone was determined to range from 6 m to 36 m.Within the fracture zone,the strata are highly fractured,which leads to an increase in methane emissions through seepage and diffusion processes.
基金supported by the National Natural Science Foundation of China (Nos.22177025,21807021,22177026)the Science Fund for Creative Research Groups of the Natural Science Foundation of Hebei Province (No.B2021201038)+1 种基金the Foundation of Hebei University (No.050001-513300201004)the Director’s Foundation of the Key Laboratory of Medicinal Chemistry and Molecular Diagnosis,Ministry of Education,Hebei University (No.MCMDZR2024003)。
文摘Schizophrenia(SCZ) is a severe mental disorder with an unclear pathogenesis.Increasing evidence suggests that oxidative stress(OS) may contribute to the neuropathological processes underlying SCZ.Biothiols,key endogenous antioxidants,have been proposed as potential biomarkers for the disease.However,due to the presence of the blood-brain barrier(BBB),fluorescent probes are rarely used to image biothiols in the brain of SCZ models.In this study,a series of fluorescent probes for biothiols were developed using dicyanoisophorone derivatives as fluorophores known for their excellent optical properties,and carboxylic esters as recognition units.A parallel synthesis and rapid screening strategy was employed to construct and optimize these probes.By introducing trifluoromethyl and benzothiazole groups into the fluorophore,the emission wavelength was successfully shifted into the near-infrared region.Additionally,various trifluoromethyl-substituted aromatic and nitrogen heterocyclic compounds were incorporated to optimize the carboxylic esters,thereby improving the probes' reactivity and lipophilicity.Systematic evaluation of the physicochemical characteristics,and optical performance led to the identification of DCIBT-11 as the most promising candidate.DCI-BT-11 demonstrated excellent BBB permeability and a good response to biothiols both in vitro and in vivo.Notably,DCI-BT-11 was used for the first time to visualize biothiol flux and assess the therapeutic effects of the antioxidant N-acetylcysteine(NAC) in the brains of SCZ mouse models,offering new insights into the role of OS in the pathogenesis and treatment of SCZ.
基金supported by the National Key Research and Development Program of China (No.2024YFA1509600)National Natural Science Foundation of China (Nos.22474010 and 22274012)the Fundamental Research Funds for the Central Universities (No.2233300007)。
文摘Ferroptosis has exhibited great potential in therapies and intracellular reducing agents of sulfur species(RSSs) in the thiol-dependent redox systems are crucial in ferroptosis.This makes the simultaneous detection of multiple RSSs significant for evaluating ferroptosis therapy.However,the traditional techniques,including fluorescent(FL) imaging and electrospray ionization-based mass spectrometry(MS) detection,cannot achieve the discrimination of different RSSs.Herein,simultaneous MS detection of multiple RSSs,including cysteine(Cys),homocysteine(Hcy),glutathione(GSH) and hydrogen sulfide(H_(2)S),was obtained upon enhancing ionization efficiency by a fluorescent probe(NBD-O-1).Based on the interaction between NBD-O-1 and RSSs,the complex of RSSs with a fragment of NBD-O-1 can be generated,which can be easily ionized for MS detection in the negative mode.Therefore,the intracellular RSSs can be well detected upon the incubation of He La cells with the probe of NBD-O-1,exhibiting the total RSS levels by the FL imaging and further providing expression of each RSS by enhanced MS detection.Furthermore,the RSSs during ferroptosis in He La cells have been evaluated using the present strategy,demonstrating the potential for ferroptosis examinations.This work has made an unconventional application of a fluorescent probe to enhance the detection of multiple RSSs by MS,providing significant molecular information for addressing the ferroptosis mechanism.
基金supported by the following grants:National Natural Science Foundation of China(Grant Nos.92354305 and 32271428),National Key R&D Program of China(Grant No.2022YFC3401100)Young Talent Program of Hubei Provincial Health Commission(WJ2025Q037)+1 种基金Interdisciplinary Research Program of HUST(Grant No.2023JCY5045)Director Fund of WNLO.
文摘Fluorescent probes,with their superior optical properties and labeling versatility,have greatly advanced the visualization of intracellular molecules and subcellular structures.However,poor cytoplasmic delivery,caused by charge,size,or targeting groups,limits the effective use of many fluorescent probes in live cells.Recently,cell-penetrating peptides(CPPs)have emerged as efficient carriers,offering great potential for the cytoplasmic delivery of fluorescent probes in live cells.This review provides a comprehensive overview of CPPs as vehicles for probe delivery,outlining advances in their development,conjugation chemistries,and intracellular delivery mechanisms.Recent applications in live-cell imaging are highlighted and organized according to major CPP modification strategies,including sequence engineering,cyclization,hybrid design and enhancement by chemical reagents.Finally,the challenges that remain and the future outlook of this rapidly evolvingfield are discussed.
基金supported by the National Natural Science Foundation of China(22225805,81400681,32394001,32121005)the Shanghai Science and Technology Innovation Action Plan(22Y11907200,23J21901600)the Innovation Program of Shanghai Municipal Education Commission,Shanghai Municipal Health Commission(2024ZZ2025)。
文摘The thoracic duct(TD),the largest lymphatic vessel in the human body,plays a critical role in returning lymph to the circulatory system.However,its dynamic,distensible nature and concealed anatomical location make intraoperative visualization critically challenging and increase the risk of injury.Real-time,high-resolution assessment of TD leaks remains an urgent clinical need.Here,we present a breakthrough molecular engineering strategy that leverages an intestinally lipophilic fluorescent formulation for dynamic in vivo TD imaging.Our rationally designed cyanine derivative IR790+,known for its rapid membrane permeability and endoplasmic reticulum(ER)targeting localization,demonstrates unprecedented chylomicron affinity,which subsequently transports the dye through the lymphatic system to the TD.Notably,dynamic,high-contrast intraoperative TD imaging is achieved from rat models to swine models.Administered orally as near-infrared(NIR)fluorescent contrast agent,this ultra-stable IR790+@oil formulation,engineered via flash nanoprecipitation,surpasses conventional counterparts by enabling non-invasive,real-time identification of TD.Intriguingly,this first-reported ER-targeting NIR formulation,delivered orally,represents a paradigm shift in fluorescence-guided surgery,significantly improving intraoperative accuracy.
基金the financial support from the National Natural Science Foundation of China(Nos.22377097,22307036,22074114)Natural Science Foundation of Hubei Province of China(Nos.2020CFB623,2021CFB556)Engineering Research Center of Phosphorus Resources Development and Utilization of Ministry of Education(No.LCX202305)。
文摘The detection of amino acid enantiomers holds significant importance in biomedical,chemical,food,and other fields.Traditional chiral recognition methods using fluorescent probes primarily rely on fluorescence intensity changes,which can compromise accuracy and repeatability.In this study,we report a novel fluorescent probe(R)-Z1 that achieves effective enantioselective recognition of chiral amino acids in water by altering emission wavelengths(>60 nm).This water-soluble probe(R)-Z1 exhibits cyan or yellow-green luminescence upon interaction with amino acid enantiomers,enabling reliable chiral detection of 14 natural amino acids.It also allows for the determination of enantiomeric excess through monitoring changes in luminescent color.Additionally,a logic operation with two inputs and three outputs was constructed based on these optical properties.Notably,amino acid enantiomers were successfully detected via dual-channel analysis at both the food and cellular levels.This study provides a new dynamic luminescence-based tool for the accurate sensing and detection of amino acid enantiomers.
基金supported by the Natural Science Foundation of Hubei Province (Nos.2023AFB376 and 2024AFD287)National Key Research and Development Program (No.2023YFC3503804)the National Natural Science Foundation of China (No.22077044)。
文摘Sulfur dioxide(SO_(2)) and its derivatives have been recognized as harmful environmental pollutants.However,they are often produced during the processing of traditional Chinese medicines,potentially compromising the quality of these medicinal materials and contributing to various health issues.Due to a lack of effective monitoring and imaging tools,the physiological effects of excessive SO_(2) residues in traditional Chinese medicine remain unclear.Therefore,developing a rapid and effective tool for detecting SO_(2) is crucial for understanding its metabolic pathways and effects in vivo.In this study,we developed a near infrared(NIR) and ratiometric fluorescent probe,NIR-RS,which exhibits high sensitivity,selectivity,and rapid response for SO_(2) detection.Notably,NIR-RS accurately quantifies SO_(2) contents in Pinelliae rhizoma(P.rhizoma) samples,with recovery rates from 98.46 % to 102.40 %,and relative standard deviations(RSDs)< 5.0 %.For bioimaging applications,NIR-RS has low cytotoxicity and good mitochondrial-targeting ability,making it suitable for imaging exogenous and endogenous SO_(2) in mitochondria.Additionally,NIR-RS was successfully applied to image SO_(2) content of P.rhizoma samples within cells,revealing that high SO_(2) residue elevated mitochondria adenosine triphosphate(ATP) content,these findings reveal that P.rhizoma with excessive SO_(2) can affect the organism's growth mechanisms through alterations in ATP pathways.In vivo,SO_(2) was found to predominantly accumulate in the liver following gavage with P.rhizoma solution,with accumulation levels increasing in proportion to SO_(2) residue concentration.High SO_(2) concentrations in P.rhizoma can cause pulmonary fibrosis and gastric mucosal damage.This work provides a valuable tool for regulating SO_(2) content in P.rhizoma and may help researcher better understand the metabolism of SO_(2) derivatives and explore their physiological roles in biological systems.
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
基金supported by the National Natural Science Foundation of China(Nos.31571511 and 31871500)
文摘DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.
基金financially supported by the National Natural Science Foundation of China(Nos.21574054,21722403,and 21420102007)
文摘We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
基金The authors thank Alexandra Surcel and Carey L Hendrix Lord for helpful comments on this manuscript.The work in our laboratory is supported by grants from the National Science Foundation(IBN-0077832,MCB-9896340,MCB-0092075)the National Institutes of Health(R0 1 GM63871)+3 种基金the US Department of Agriculture(2001-35301-10570 and 2003-35301-13313)Wuxing L was partially supported by the Intercollege Graduate Degree Program in Plant PhysiologyHong M gratefully acknowledges the support of the John Simon Guggenheim Foundationthe National Institutes of Health(F33 GM72245-1).
文摘Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.
基金supported by the National Natural Science Foundation of China(11272193 and 10872121)the Shanghai Leading Academic Discipline Project(S30106)
文摘In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.
基金supported in part by the National Natural Science Foundation of China (Grant No. 11004082)the Natural Science Foundation of Guangdong Province of China (Grant No. 01005249)the Fundamental Research Funds for the Central Universities of China (Grant No. 21609305)
文摘Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.
基金Project supported by the National Natural Science Foundation of China (Grant No.11974366)the Fundamental Research Funds for the Central Universities+2 种基金Chinathe Supercomputer Center of the Chinese Academy of Sciencesthe Shanghai Supercomputer Center of China。
文摘The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.
基金Supported by the National Natural Science Foundation of China (61205184)the Department of Education of Zhejiang Province (Y201122207)+1 种基金Open Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (YR2012013)the Young Researchers Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (ZYG2012003)
文摘A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.
文摘A zinc sulfate open framework matrix,[Zn(SO_4)(DMSO)](1),was synthesized by solvothermal evaporationusing dimethyl sulfoxide(DMSO)as the solvent.A compositeP@1,which exhibits fluorescence and room tempera-ture phosphorescence(RTP)properties,was prepared by doping 2,6-naphthalic acid(P)into matrix1at a low con-centration.P@1emitted a green RTP that was visible to the naked eye and lasted for approximately 2 s.P@1exhib-ited selective phosphorescence enhancement response towards Pb^(2+),with a detection limit of 2.52μmol·L^(-1).Themain detection mechanism is the Pb—O coordination-induced phosphorescence enhancement in the system.Inter-estingly,P@1also functioned as a dual-channel probe for the rapid detection of Fe^(3+)ions through fluorescencequenching with a detection limit of 0.038μmol·L^(-1).The recognition mechanism may be attributed to the competi-tive energy absorption betweenP@1and Fe^(3+)ions.CCDC:2388502,1.
文摘To address the lack of systematic studies on heavy metal fluorescent probes in typical buffer solutions,this study developed a Fe^(3+)and Cu^(2+)fluorescent probe,DHU‑NP‑4,based on a naphthalimide fluorophore.Comparative analysis of the probe's performance in various buffer systems revealed that buffers with high organic content are unsuitable for evaluating such probes.Furthermore,the pH of the solvent system was found to significantly influence the probe's behavior.Under highly acidic conditions(pH≤2),DHU‑NP‑4 exhibited exceptional specificity for Fe^(3+),while in alkaline conditions,it demonstrated high specificity for Cu^(2+).Leveraging these properties,the probe enabled the quantitative detection of Fe^(3+)and Cu^(2+)in solution.
基金the National Natural Science Foundation of China(Nos.22325703,22377071,U23A6009)Research Project Supported by Shanxi Scholarship Council of China(No.2022-002)+1 种基金the Shanxi Province Science Foundation(No.202203021221009)Shanxi Province Science and Technology activities for overseas people selected funding project(No.2024001)。
文摘Rheumatoid arthritis(RA) is a chronic inflammatory disease with multi-system damage and autoimmune features.The main clinical manifestations of RA include joint pain,swelling,and stiffness,and RA may lead to joint deformity and dysfunction in severe cases.The pathologic development of RA involves complex interactions of multiple biomarkers,and detecting a single biomarker may produce falsepositive results due to other confounding factors.Therefore,fluorescent probes that can detect multiple biomarkers simultaneously are crucial for precise RA diagnosis.Peroxynitrite(ONOO^(-)) and viscosity are inflammation-related factors in cells.In this study,we developed a dual responsive near-infrared fluorescent probe,YLS,for ONOO^(-) and viscosity.The probe features dual-channel turn-on fluorescence responses at 625 and 760 nm upon the presence of ONOO^(-) and viscosity,respectively.Supported by YLS,we found that during RA pathology,lymphocyte infiltration not only increases the concentration of proteins in the joint fluid resulting in elevated viscosity;at the same time,the overproduction of ONOO^(-) exacerbates oxidative stress and inflammatory responses.This multiparameter assay is expected to improve the diagnostic accuracy of the early stages of RA,thus providing a scientific basis for early intervention and personalized treatment.
