DNA is the hereditary material in humans and almost all other organisms. It is essential for maintaining accurate transmission of genetic information. In the life cycle, DNA replication, cell division, or genome damag...DNA is the hereditary material in humans and almost all other organisms. It is essential for maintaining accurate transmission of genetic information. In the life cycle, DNA replication, cell division, or genome damage, including that caused by endogenous and exogenous agents, may cause DNA aberrations. Of all forms of DNA damage, DNA double-strand breaks(DSBs) are the most serious. If the repair function is defective, DNA damage may cause gene mutation, genome instability, and cell chromosome loss, which in turn can even lead to tumorigenesis. DNA damage can be repaired through multiple mechanisms. Homologous recombination(HR) and non-homologous end joining(NHEJ) are the two main repair mechanisms for DNA DSBs. Increasing amounts of evidence reveal that protein modifications play an essential role in DNA damage repair.Protein deubiquitination is a vital post-translational modification which removes ubiquitin molecules or polyubiquitinated chains from substrates in order to reverse the ubiquitination reaction. This review discusses the role of deubiquitinating enzymes(DUBs) in repairing DNA DSBs. Exploring the molecular mechanisms of DUB regulation in DSB repair will provide new insights to combat human diseases and develop novel therapeutic approaches.展开更多
DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rear...DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.展开更多
The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
Maintenance of cellular homeostasis and genome integrity is a critical responsibility of DNA double-strand break(DSB)signaling.P53-binding protein 1(53BP1)plays a critical role in coordinating the DSB repair pathway c...Maintenance of cellular homeostasis and genome integrity is a critical responsibility of DNA double-strand break(DSB)signaling.P53-binding protein 1(53BP1)plays a critical role in coordinating the DSB repair pathway choice and promotes the non-homologous end-joining(NHEJ)-mediated DSB repair pathway that rejoins DSB ends.New insights have been gained into a basic molecular mechanism that is involved in 53BP1 recruitment to the DNA lesion and how 53BP1 then recruits the DNA break-responsive effectors that promote NHEJ-mediated DSB repair while inhibiting homologous recombination(HR)signaling.This review focuses on the up-and downstream pathways of 53BP1 and how 53BP1 promotes NHEJ-mediated DSB repair,which in turn promotes the sensitivity of poly(ADP-ribose)polymerase inhibitor(PARPi)in BRCA1-deficient cancers and consequently provides an avenue for improving cancer therapy strategies.展开更多
Meiosis is an essential step in gametogenesis which is the key process in sexually reproducing organisms as meiotic aberrations may result in infertility. In meiosis, programmed DNA double-strand break (DSB) formation...Meiosis is an essential step in gametogenesis which is the key process in sexually reproducing organisms as meiotic aberrations may result in infertility. In meiosis, programmed DNA double-strand break (DSB) formation is one of the fundamental processes that are essential for maintaining homolog interactions and correcting segregation of chromosomes. Although the number and distribution of meiotic DSBs are tightly regulated, still abnormalities in DSB formation are known to cause meiotic arrest and infertility. This review is a detailed account of molecular bases of meiotic DSB formation, its evolutionary conservation, and variations in different species. We further reviewed the mutations of DSB formation genes in association with human infertility and also proposed the future directions and strategies about the study of meiotic DSB formation.展开更多
The clustered regularly interspaced short palindromic repeats(CRISPR)/CRISPR-associated protein 9(Cas9)is widely used for targeted genomic and epigenomic modifications and imaging in cells and organisms,and holds trem...The clustered regularly interspaced short palindromic repeats(CRISPR)/CRISPR-associated protein 9(Cas9)is widely used for targeted genomic and epigenomic modifications and imaging in cells and organisms,and holds tremendous promise in clinical applications.The efficiency and accuracy of the technology are partly determined by the target binding affinity and residence time of Cas9-single-guide RNA(sgRNA)at a given site.However,little attention has been paid to the effect of target binding affinity and residence duration on the repair of Cas9-induced DNA double-strand breaks(DSBs).We propose that the choice of DSB repair pathway may be altered by variation in the binding affinity and residence duration of Cas9-sgRNA at the cleaved target,contributing to significantly heterogeneous mutations in CRISPR/Cas9 genome editing.Here,we discuss the effect of Cas9-sgRNA target binding and residence on the choice of DSB repair pathway in CRISPR/Cas9 genome editing,and the opportunity this presents to optimize Cas9-based technology.展开更多
We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to ...We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.展开更多
Hepatitis B virus(HBV)-induced hepatocellular carcinoma(HCC) is one of the most fre-quently occurring cancers.Hepadnaviral DNA integrations are considered to be essential agents which can promote the process of the he...Hepatitis B virus(HBV)-induced hepatocellular carcinoma(HCC) is one of the most fre-quently occurring cancers.Hepadnaviral DNA integrations are considered to be essential agents which can promote the process of the hepatocarcinogenesis.More and more researches were designed to find the relationship of the two.In this study,we investigated whether HBV DNA integration occurred at sites of DNA double-strand breaks(DSBs),one of the most detrimental DNA damage.An 18-bp I-SceI homing endonuclease recognition site was introduced into the DNA of HepG2 cell line by stable DNA transfection,then cells were incubated in patients’ serum with high HBV DNA copies and at the same time,DSBs were induced by transient expression of I-SceI after transfection of an I-SceI expression vector.By using nest PCR,the viral DNA was detected at the sites of the break.It appeared that integra-tion occurred between part of HBV x gene and the I-SceI induced breaks.The results suggested that DSBs,as the DNA damages,may serve as potential targets for hepadnaviral DNA insertion and the integrants would lead to widespread host genome changes necessarily.It provided a new site to investi-gate the integration.展开更多
DNA damage in oocytes can cause infertility and birth defects. DNA double-strand breaks （DSBs） are highly deleterious and can substantially impair genome integrity. Homologous recombination （HR）-mediated DNA DSB r...DNA damage in oocytes can cause infertility and birth defects. DNA double-strand breaks （DSBs） are highly deleterious and can substantially impair genome integrity. Homologous recombination （HR）-mediated DNA DSB repair plays dominant roles in safeguarding oocyte quantity and quality. However, little is known regarding the key players of the HR repair pathway in oocytes. Here, we identified oocyte-specific gene Ooep as a novel key component of the HR repair pathway in mouse oocytes. OOEP was required for efficient ataxia telangiectasia mutated （ATM） kinase activation and Rad51 recombinase （RAD51） focal accumulation at DNA DSBs. Ooep null oocytes were defective in DNA DSB repair and prone to apoptosis upon exogenous DNA damage insults. Moreover, Ooep null oocytes exhibited delayed meiotic maturation. Therefore, OOEP played roles in preserving oocyte quantity and quality by maintaining genome stability. Ooep expression decreased with the advance of maternal age, suggesting its involvement in maternal aging.展开更多
In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chro...Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.展开更多
In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal a...In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.展开更多
Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric ...Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.展开更多
The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work...The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.展开更多
A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was charact...A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.展开更多
Gene targeting technology is an important means to investigate gene functions, but its efficiency of gene targeting is very low, especially for somatic cell targeting. Artificially induced double-strand breaks （DSB）...Gene targeting technology is an important means to investigate gene functions, but its efficiency of gene targeting is very low, especially for somatic cell targeting. Artificially induced double-strand breaks （DSB） and triplex forming oligonucleotide （TFO） are currently developed methods to improve the targeting efficiency. This paper summarized the basic principles, design ideas and application in gene targeting efficiency improvement of these two methods, analyzed and com- pared their characteristics, and finally proposed prospects for their future development.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbe...The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbent assay (ELISA) was used to quantify γH2AX, a molecular marker for DSBs, in the blood of mice after a 6-hour exposure to magnetic resonance imaging (MRI). Fourteen CF-1 female mice were separated into 4 experimental groups: Untreated negative control, MRI-treated, MRI-Control, and exposed to ionizing radiation positive control. Untreated negative control was used as a baseline for ELISA to quantify γH2AX. MRI-treated consisted of a 6-hour continuous magnetic resonance imaging (MRI) echo planar imaging (EPI) sequence with a slew rate of 192 mT/m/s constituting a significantly longer imaging time than routine clinical imaging. MRI-control mice were maintained under the same conditions outside the MRI scanner for 6-hours. Mice in the irradiation group served as a positive control of DSBs and were exposed to either 2 Gy, 5 Gy or 10 Gy of ionizing radiation. DSBs in the blood lymphocytes from the treatment groups were analyzed using the γH2AX ELISA and compared. Total protein concentration in lysates was determined for each blood sample and averaged 1 ± 0.35 mg/mL. Irradiated positive controls were used to test radiation dose-dependency of the γH2AX ELISA assay where a linear dependency on radiation exposure was observed (r<sup>2</sup> = 0.93) between untreated and irradiated samples. Mean and standard error mean of γH2AX formation were calculated and compared between each treatment group. Repeated measures 1-way ANOVA showed statistically significant differences between the means of irradiated controls and both the MRI-control and MRI-treated groups. There was no statistically significant difference between the MRI-treated samples and the MRI-control groups. Our results show that long MRI exposure at a high slew rate did not cause increased levels of γH2AX when compared to control mice, suggesting that no increase in DSBs was caused by the long MR thermometry imaging session. The novelty of this work contradicts other studies that have suggested MRI may cause DSBs;this work suggests an alternative cause of DNA damage.展开更多
5-Hydroxymethylcytosine(5hmC)is a crucial DNA modification that participates in the regulation of various physiological processes.Although several methods have been developed to map 5hmC,there is still a high demand f...5-Hydroxymethylcytosine(5hmC)is a crucial DNA modification that participates in the regulation of various physiological processes.Although several methods have been developed to map 5hmC,there is still a high demand for genome-wide mapping at single-base resolution.Consequently,we developed a double-stranded DNA deamination sequencing(DDD-seq)approach for genome-wide mapping of 5hmC at single-base resolution.DDD-seq utilizes the double-stranded DNA deaminase SsdA_(cat)from Pseudomonas syringae,which efficiently deaminates cytosine(C),5-methylcytosine(5mC),5hmC,5-formylcytosine(5fC),and 5-carboxylcytosine(5caC)in duplex DNA,but not glycosylated 5hmC(5gmC).In DDD-seq,C,5mC,5fC,and 5caC in dsDNA are deaminated by SsdA_(cat)and read as T in sequencing,while 5gmC resists deamination,allowing its identification by detecting as C in sequencing.The map of 5hmC generated by DDD-seq inmouse cerebellum tissue closely aligns with that obtained from the ACE-seq method.Applying DDD-seq to mouse cerebellum tissue subjected to chronic sleep deprivation revealed significant changes of 5hmC distribution in genomic DNA.In contrast to previous single-stranded deaminase APOBEC3A-based mapping methods that require denaturation of dsDNA into ssDNA,DDD-seq eliminates this step,reducing risks associated with incomplete denaturation and simplifying sequencing library construction.Additionally,SsdA_(cat)demonstrates superior thermostability and activity across a wide range of pH values and temperatures,making DDD-seq applicable in broader scenarios with more accessible conditions.Collectively,the DDD-seq method is straightforward,bisulfite-free,and eliminates the need for DNA denaturation step,making it a valuable tool for mapping 5hmC in genomes at single-base resolution.展开更多
The development of artificial supramolecular double-stranded helical structures has received widespread attention;however,the reports focusing on the construction and resolution of double-stranded helical assemblies b...The development of artificial supramolecular double-stranded helical structures has received widespread attention;however,the reports focusing on the construction and resolution of double-stranded helical assemblies based on terpyridine are relatively scarce.Herein,we report a series of extremely low-symmetry double-stranded helicates(S^(3),S^(4),and S^(R/S))based on the head-totail coordination mode of ladder-style ligands(L^(3),L^(4),and LR/S),which are apparently different from the conventional helicates with symmetrical axis.The ladder-style tridentate ligand L^(3)was first designed and synthesized by characteristic consecutive unsymmetrical modification of terpyridine.The chiral group 2,6-bis(oxazolinyl)pyridine(Py Box)was designed at the tail of tridentate ligand L^(3)and achieved the chiral resolution of the assembly.Moreover,the self-assembly of mixed three ladder-style ligands(didentate L2,tridentate L^(3),and tetradentate L^(4))and single terpyridine ligand(L^(1))with Zn(Ⅱ)also exhibited excellent narcissistic self-sorting behavior,without any statistical mixture.展开更多
基金supported by the National Natural Science Foundation of China (Nos. 91749115 and 81872298)the Natural Science Foundation of Jiangxi Province (No. 20181BAB205044), China。
文摘DNA is the hereditary material in humans and almost all other organisms. It is essential for maintaining accurate transmission of genetic information. In the life cycle, DNA replication, cell division, or genome damage, including that caused by endogenous and exogenous agents, may cause DNA aberrations. Of all forms of DNA damage, DNA double-strand breaks(DSBs) are the most serious. If the repair function is defective, DNA damage may cause gene mutation, genome instability, and cell chromosome loss, which in turn can even lead to tumorigenesis. DNA damage can be repaired through multiple mechanisms. Homologous recombination(HR) and non-homologous end joining(NHEJ) are the two main repair mechanisms for DNA DSBs. Increasing amounts of evidence reveal that protein modifications play an essential role in DNA damage repair.Protein deubiquitination is a vital post-translational modification which removes ubiquitin molecules or polyubiquitinated chains from substrates in order to reverse the ubiquitination reaction. This review discusses the role of deubiquitinating enzymes(DUBs) in repairing DNA DSBs. Exploring the molecular mechanisms of DUB regulation in DSB repair will provide new insights to combat human diseases and develop novel therapeutic approaches.
基金supported by the National Natural Science Foundation of China(Nos.31571511 and 31871500)
文摘DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
文摘Maintenance of cellular homeostasis and genome integrity is a critical responsibility of DNA double-strand break(DSB)signaling.P53-binding protein 1(53BP1)plays a critical role in coordinating the DSB repair pathway choice and promotes the non-homologous end-joining(NHEJ)-mediated DSB repair pathway that rejoins DSB ends.New insights have been gained into a basic molecular mechanism that is involved in 53BP1 recruitment to the DNA lesion and how 53BP1 then recruits the DNA break-responsive effectors that promote NHEJ-mediated DSB repair while inhibiting homologous recombination(HR)signaling.This review focuses on the up-and downstream pathways of 53BP1 and how 53BP1 promotes NHEJ-mediated DSB repair,which in turn promotes the sensitivity of poly(ADP-ribose)polymerase inhibitor(PARPi)in BRCA1-deficient cancers and consequently provides an avenue for improving cancer therapy strategies.
基金This work was supported by the National Key Research and Developmental Program of China(2018YFC1003700,2018YFC1003400,and 2016YFC1000600)the Strategic Priority Research Program of the Chinese Academy of Sciences(XDB19000000)+1 种基金the National Natural Science Foundation of China(31890780,31630050,32061143006,82071709,and 31871514)the Fundamental Research Funds for the Central Universities(YD2070002006).
文摘Meiosis is an essential step in gametogenesis which is the key process in sexually reproducing organisms as meiotic aberrations may result in infertility. In meiosis, programmed DNA double-strand break (DSB) formation is one of the fundamental processes that are essential for maintaining homolog interactions and correcting segregation of chromosomes. Although the number and distribution of meiotic DSBs are tightly regulated, still abnormalities in DSB formation are known to cause meiotic arrest and infertility. This review is a detailed account of molecular bases of meiotic DSB formation, its evolutionary conservation, and variations in different species. We further reviewed the mutations of DSB formation genes in association with human infertility and also proposed the future directions and strategies about the study of meiotic DSB formation.
基金supported by the National Natural Science Foundation of China(Nos.31671385 and 31870806)the Zhejiang Provincial Natural Science Foundation of China(Nos.LY18C050001 and LQ20C050004)the Fundamental Research Funds for the Central Universities in China(No.2019QNA7031)。
文摘The clustered regularly interspaced short palindromic repeats(CRISPR)/CRISPR-associated protein 9(Cas9)is widely used for targeted genomic and epigenomic modifications and imaging in cells and organisms,and holds tremendous promise in clinical applications.The efficiency and accuracy of the technology are partly determined by the target binding affinity and residence time of Cas9-single-guide RNA(sgRNA)at a given site.However,little attention has been paid to the effect of target binding affinity and residence duration on the repair of Cas9-induced DNA double-strand breaks(DSBs).We propose that the choice of DSB repair pathway may be altered by variation in the binding affinity and residence duration of Cas9-sgRNA at the cleaved target,contributing to significantly heterogeneous mutations in CRISPR/Cas9 genome editing.Here,we discuss the effect of Cas9-sgRNA target binding and residence on the choice of DSB repair pathway in CRISPR/Cas9 genome editing,and the opportunity this presents to optimize Cas9-based technology.
基金financially supported by the National Natural Science Foundation of China(Nos.21574054,21722403,and 21420102007)
文摘We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.
基金supported by grants from National Natural Sciences Foundation of China (No.30872237)the National Basic Research Program of China(No.2007CB512900)
文摘Hepatitis B virus(HBV)-induced hepatocellular carcinoma(HCC) is one of the most fre-quently occurring cancers.Hepadnaviral DNA integrations are considered to be essential agents which can promote the process of the hepatocarcinogenesis.More and more researches were designed to find the relationship of the two.In this study,we investigated whether HBV DNA integration occurred at sites of DNA double-strand breaks(DSBs),one of the most detrimental DNA damage.An 18-bp I-SceI homing endonuclease recognition site was introduced into the DNA of HepG2 cell line by stable DNA transfection,then cells were incubated in patients’ serum with high HBV DNA copies and at the same time,DSBs were induced by transient expression of I-SceI after transfection of an I-SceI expression vector.By using nest PCR,the viral DNA was detected at the sites of the break.It appeared that integra-tion occurred between part of HBV x gene and the I-SceI induced breaks.The results suggested that DSBs,as the DNA damages,may serve as potential targets for hepadnaviral DNA insertion and the integrants would lead to widespread host genome changes necessarily.It provided a new site to investi-gate the integration.
基金supported by the National Key Research and Development Program of China(2017YFC1001102)National Natural Science Foundation of China(81760507)
文摘DNA damage in oocytes can cause infertility and birth defects. DNA double-strand breaks （DSBs） are highly deleterious and can substantially impair genome integrity. Homologous recombination （HR）-mediated DNA DSB repair plays dominant roles in safeguarding oocyte quantity and quality. However, little is known regarding the key players of the HR repair pathway in oocytes. Here, we identified oocyte-specific gene Ooep as a novel key component of the HR repair pathway in mouse oocytes. OOEP was required for efficient ataxia telangiectasia mutated （ATM） kinase activation and Rad51 recombinase （RAD51） focal accumulation at DNA DSBs. Ooep null oocytes were defective in DNA DSB repair and prone to apoptosis upon exogenous DNA damage insults. Moreover, Ooep null oocytes exhibited delayed meiotic maturation. Therefore, OOEP played roles in preserving oocyte quantity and quality by maintaining genome stability. Ooep expression decreased with the advance of maternal age, suggesting its involvement in maternal aging.
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
基金The authors thank Alexandra Surcel and Carey L Hendrix Lord for helpful comments on this manuscript.The work in our laboratory is supported by grants from the National Science Foundation(IBN-0077832,MCB-9896340,MCB-0092075)the National Institutes of Health(R0 1 GM63871)+3 种基金the US Department of Agriculture(2001-35301-10570 and 2003-35301-13313)Wuxing L was partially supported by the Intercollege Graduate Degree Program in Plant PhysiologyHong M gratefully acknowledges the support of the John Simon Guggenheim Foundationthe National Institutes of Health(F33 GM72245-1).
文摘Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.
基金supported by the National Natural Science Foundation of China(11272193 and 10872121)the Shanghai Leading Academic Discipline Project(S30106)
文摘In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.
基金supported in part by the National Natural Science Foundation of China (Grant No. 11004082)the Natural Science Foundation of Guangdong Province of China (Grant No. 01005249)the Fundamental Research Funds for the Central Universities of China (Grant No. 21609305)
文摘Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.
基金Project supported by the National Natural Science Foundation of China (Grant No.11974366)the Fundamental Research Funds for the Central Universities+2 种基金Chinathe Supercomputer Center of the Chinese Academy of Sciencesthe Shanghai Supercomputer Center of China。
文摘The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.
基金Supported by the National Natural Science Foundation of China (61205184)the Department of Education of Zhejiang Province (Y201122207)+1 种基金Open Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (YR2012013)the Young Researchers Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (ZYG2012003)
文摘A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.
基金Supported by Shandong Swine Industry Technology System and Science and Technology Planning Program for Basic Research in Qingdao City(12-1-4-14-jch)
文摘Gene targeting technology is an important means to investigate gene functions, but its efficiency of gene targeting is very low, especially for somatic cell targeting. Artificially induced double-strand breaks （DSB） and triplex forming oligonucleotide （TFO） are currently developed methods to improve the targeting efficiency. This paper summarized the basic principles, design ideas and application in gene targeting efficiency improvement of these two methods, analyzed and com- pared their characteristics, and finally proposed prospects for their future development.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
文摘The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbent assay (ELISA) was used to quantify γH2AX, a molecular marker for DSBs, in the blood of mice after a 6-hour exposure to magnetic resonance imaging (MRI). Fourteen CF-1 female mice were separated into 4 experimental groups: Untreated negative control, MRI-treated, MRI-Control, and exposed to ionizing radiation positive control. Untreated negative control was used as a baseline for ELISA to quantify γH2AX. MRI-treated consisted of a 6-hour continuous magnetic resonance imaging (MRI) echo planar imaging (EPI) sequence with a slew rate of 192 mT/m/s constituting a significantly longer imaging time than routine clinical imaging. MRI-control mice were maintained under the same conditions outside the MRI scanner for 6-hours. Mice in the irradiation group served as a positive control of DSBs and were exposed to either 2 Gy, 5 Gy or 10 Gy of ionizing radiation. DSBs in the blood lymphocytes from the treatment groups were analyzed using the γH2AX ELISA and compared. Total protein concentration in lysates was determined for each blood sample and averaged 1 ± 0.35 mg/mL. Irradiated positive controls were used to test radiation dose-dependency of the γH2AX ELISA assay where a linear dependency on radiation exposure was observed (r<sup>2</sup> = 0.93) between untreated and irradiated samples. Mean and standard error mean of γH2AX formation were calculated and compared between each treatment group. Repeated measures 1-way ANOVA showed statistically significant differences between the means of irradiated controls and both the MRI-control and MRI-treated groups. There was no statistically significant difference between the MRI-treated samples and the MRI-control groups. Our results show that long MRI exposure at a high slew rate did not cause increased levels of γH2AX when compared to control mice, suggesting that no increase in DSBs was caused by the long MR thermometry imaging session. The novelty of this work contradicts other studies that have suggested MRI may cause DSBs;this work suggests an alternative cause of DNA damage.
基金supported by the National Key R&D Program of China(grant nos.2022YFC3400700 and 2022YFA0806600)the Fundamental Research Funds for the Central Universities(grant no.2042024kf0022)+1 种基金the National Natural Science Foundation of China(grant nos.22074110,22277093,and 22307099)the Key Research and Development Project of Hubei Province(grant no.2023BCB094).
文摘5-Hydroxymethylcytosine(5hmC)is a crucial DNA modification that participates in the regulation of various physiological processes.Although several methods have been developed to map 5hmC,there is still a high demand for genome-wide mapping at single-base resolution.Consequently,we developed a double-stranded DNA deamination sequencing(DDD-seq)approach for genome-wide mapping of 5hmC at single-base resolution.DDD-seq utilizes the double-stranded DNA deaminase SsdA_(cat)from Pseudomonas syringae,which efficiently deaminates cytosine(C),5-methylcytosine(5mC),5hmC,5-formylcytosine(5fC),and 5-carboxylcytosine(5caC)in duplex DNA,but not glycosylated 5hmC(5gmC).In DDD-seq,C,5mC,5fC,and 5caC in dsDNA are deaminated by SsdA_(cat)and read as T in sequencing,while 5gmC resists deamination,allowing its identification by detecting as C in sequencing.The map of 5hmC generated by DDD-seq inmouse cerebellum tissue closely aligns with that obtained from the ACE-seq method.Applying DDD-seq to mouse cerebellum tissue subjected to chronic sleep deprivation revealed significant changes of 5hmC distribution in genomic DNA.In contrast to previous single-stranded deaminase APOBEC3A-based mapping methods that require denaturation of dsDNA into ssDNA,DDD-seq eliminates this step,reducing risks associated with incomplete denaturation and simplifying sequencing library construction.Additionally,SsdA_(cat)demonstrates superior thermostability and activity across a wide range of pH values and temperatures,making DDD-seq applicable in broader scenarios with more accessible conditions.Collectively,the DDD-seq method is straightforward,bisulfite-free,and eliminates the need for DNA denaturation step,making it a valuable tool for mapping 5hmC in genomes at single-base resolution.
基金supported by the Natural Science Foundation of Jilin Province(20230101027JC for M.Wang)the National Natural Science Foundation of China(22071079 for M.Wang)the Natural Science Foundation of Xinjiang Uygur Autonomous Region(2023D01C203 for J.Ma)。
文摘The development of artificial supramolecular double-stranded helical structures has received widespread attention;however,the reports focusing on the construction and resolution of double-stranded helical assemblies based on terpyridine are relatively scarce.Herein,we report a series of extremely low-symmetry double-stranded helicates(S^(3),S^(4),and S^(R/S))based on the head-totail coordination mode of ladder-style ligands(L^(3),L^(4),and LR/S),which are apparently different from the conventional helicates with symmetrical axis.The ladder-style tridentate ligand L^(3)was first designed and synthesized by characteristic consecutive unsymmetrical modification of terpyridine.The chiral group 2,6-bis(oxazolinyl)pyridine(Py Box)was designed at the tail of tridentate ligand L^(3)and achieved the chiral resolution of the assembly.Moreover,the self-assembly of mixed three ladder-style ligands(didentate L2,tridentate L^(3),and tetradentate L^(4))and single terpyridine ligand(L^(1))with Zn(Ⅱ)also exhibited excellent narcissistic self-sorting behavior,without any statistical mixture.
