This article provides a comprehensive review of various approaches to targeted drug delivery for liver cancer, an area of significant need due to the limited effectiveness of current treatments. The article begins by ...This article provides a comprehensive review of various approaches to targeted drug delivery for liver cancer, an area of significant need due to the limited effectiveness of current treatments. The article begins by highlighting the role of the liver in metabolism and discusses the high mortality associated with hepatocellular carcinoma (HCC). The shortcomings of traditional chemotherapy, such as multidrug resistance and off-target effects, necessitate the exploration of novel therapeutic strategies, with a focus on targeted approaches. The review details both passive and active targeting strategies. Passive targeting leverages the enhanced permeability and retention (EPR) effect and unique features of the tumor microenvironment, while active targeting employs specific ligands, such as peptides, antibodies, and proteins, to bind to overexpressed receptors on liver and tumor cells. The article further details many examples of active targeting using the asialoglycoprotein receptor (ASGPR), glycyrrhetinic acid (GA), transferrin receptor (TfR), and folate receptor (FR) on hepatocytes and tumor cells, demonstrating that there has been significant research effort put into this field. The importance of non-parenchymal cells in the liver is also discussed, and the article examines methods of targeting Kupffer cells, sinusoidal endothelial cells, and hepatic stellate cells for therapeutic benefit. The review goes on to cover the emerging field of subcellular targeting, including specific strategies to target the nucleus, mitochondria, and the endoplasmic reticulum/Golgi apparatus, noting that although there has been some progress, further research is needed in this area. The text finishes with a summary which acknowledges that while targeted therapies, including enzyme-activated prodrugs, such as Pradefovir, and other novel methods for drug delivery have shown significant promise, challenges remain in translating these therapies into clinical use due to limitations in understanding the sequential transport and the mechanisms of action. Ultimately, the article emphasizes the need for in-depth research to fully realize the potential of precision cancer therapies for liver cancer.展开更多
Hydrogen peroxide(H2 O2), as important products of oxygen metabolism, plays an important role in many biological processes, such as immune responses and cellular signal transduction. However, abnormal production of H2...Hydrogen peroxide(H2 O2), as important products of oxygen metabolism, plays an important role in many biological processes, such as immune responses and cellular signal transduction. However, abnormal production of H2 O2 can damage cellular biomolecules, which was closely associated with many diseases.Thus, it is urgent to monitor the level change of H2 O2 in living cells, particularly at subcellular levels.Toward this end, a wide variety of H2 O2 fluorescent probes have been designed, developed and applied for imaging of H2 O2 in subcellular levels. In this review, we highlight the representative cases of H2 O2 fluorescent probes with mitochondria, nuclei and lysosomes-targetable ability. The review contains organelle target strategies, structures, fluorescence behavior and biological applications of these probes.展开更多
Cutaneous malignant melanoma is the most aggressive form of skin cancer with an extremely poor survival rate for the patients diagnosed with locally invasive and metastatic disease states. Intensive research has led i...Cutaneous malignant melanoma is the most aggressive form of skin cancer with an extremely poor survival rate for the patients diagnosed with locally invasive and metastatic disease states. Intensive research has led in last few years to an improvement of the early detection and curative treatment of primary cutaneous melanomas that are confined to the skin by tumor surgical resection. However, locally advanced and disseminated melanomas are generally resistant to conventional treatments, including ionizing radiation, systemic chemotherapy, immunotherapy and/or adjuvant stem cellbased therapies, and result in the death of patients. The rapid progression of primary melanomas to locally invasive and/or metastatic disease states remains a major obstacle for an early effective diagnosis and a curative therapeutic intervention for melanoma patients. Importantly, recent advances in the melanoma research have led to the identification of different gene products that are often implicated in the malignant transforma-tion of melanocytic cells into melanoma cells, including melanoma stem/progenitor cells, during melanoma initiation and progression to locally advanced and metastatic disease states. The frequent deregulated genes products encompass the oncogenic B-Raf V600 E and N-RasQ 61 R mutants, different receptor tyrosine kinases and developmental pathways such as epidermal growth factor receptor(EGFR), stem cell-like factor(SCF) receptor KIT, hedgehog, Wnt/β-catenin, Notch, stromal cell-derived factor-1(SDF-1)/CXC chemokine receptor-4(CXCR4) and vascular endothelial growth factor(VEGF)/VEGFR receptor. These growth factors can cooperate to activate distinct tumorigenic downstream signaling elements and epithelial-mesenchymal transition(EMT)-associated molecules, including phosphatidylinositol 3'-kinase(PI3K)/Akt/ molecular target of rapamycin(mT OR), nuclear factor-kappaB(NF-κB), macrophage inhibitory cytokine-1(MIC-1), vimentin, snail and twist. Of therapeutic relevance, these deregulated signal transduction components constitute new potential biomarkers and therapeutic targets of great clinical interest for improving the efficacy of current diagnostic and prognostic methods and management of patients diagnosed with locally advanced, metastatic and/or relapsed melanomas.展开更多
Bone tumour is one of most common primary cancer which exhibits cancerous osteoblastic differentiation and malignant osteoid in patients.At present,chemotherapy(pre-and post-operative)is used as a standard treatment p...Bone tumour is one of most common primary cancer which exhibits cancerous osteoblastic differentiation and malignant osteoid in patients.At present,chemotherapy(pre-and post-operative)is used as a standard treatment protocol for bone tumour.However,drugs used in the treatment of bone tumour induce high toxicity to normal tissues including anaemia,neutropenia,thrombocytopenia,and heart damage which further reduce the survival rate of patients.Therefore,there is an urgent need to develop a new therapeutic approach for the treatment such that it induce maximum cell killing effect in tumor cells while sparing the healthy bone cells.In this article,some new perspectives were provided on the development of bone-targeted nano-drug carriers for bone cancer treatment.We hope such discussions wouldencourage more detailed and careful studies to support product development of bone-targeted drug carriers for bone cancer treatment.展开更多
Lung cancer is responsible for 29% of cancer deaths in the United States and has very low 5-year survival rates of approximately 11% in men and 15% in women.Although the early diagnosis of lung cancer may increase the...Lung cancer is responsible for 29% of cancer deaths in the United States and has very low 5-year survival rates of approximately 11% in men and 15% in women.Although the early diagnosis of lung cancer may increase the survival rate with adequate treatment,advanced lung cancers are often metastasized and receive limited benefit from therapeutic regimens.As conventional treatments for lung cancer reach their limitations,researchers have attempted to discover novel drug therapies aimed at specific targets contributing to the progression of tumorigenesis.Recent advances in systems biology have enabled the molecular biology of lung carcinogenesis to be elucidated.Our understanding of the physiologic processes of tumor development provide a means to design more effective and specific drugs with less toxicity,thereby accelerating the delivery of new drug therapies to the patient's bedside.展开更多
In multiple extended targets tracking, replacing traditional multiple measurements with a rectangular region of the nonzero volume in the state space inspired by the box-particle idea is exactly suitable to deal with ...In multiple extended targets tracking, replacing traditional multiple measurements with a rectangular region of the nonzero volume in the state space inspired by the box-particle idea is exactly suitable to deal with extended targets, without distinguishing the measurements originating from the true targets or clutter.Based on our recent work on extended box-particle probability hypothesis density(ET-BP-PHD) filter, we propose the extended labeled box-particle cardinalized probability hypothesis density(ET-LBP-CPHD) filter, which relaxes the Poisson assumptions of the extended target probability hypothesis density(PHD) filter in target numbers, and propagates not only the intensity function but also cardinality distribution. Moreover, it provides the identity of individual target by adding labels to box-particles. The proposed filter can improve the precision of estimating target number meanwhile achieve targets' tracks. The effectiveness and reliability of the proposed algorithm are verified by the simulation results.展开更多
MicroRNAs(miRNAs) are a population of highly conserved specific small ribo-regulators that negatively regulate gene expressions in both plants and animals.They play a key role in post-transcriptional gene regulation...MicroRNAs(miRNAs) are a population of highly conserved specific small ribo-regulators that negatively regulate gene expressions in both plants and animals.They play a key role in post-transcriptional gene regulation by destabilizing the target gene transcripts or blocking protein translation from them.Interestingly,these negative regulators are largely compromised by an upstream layer of negative regulators "target mimics" found in plants or "endogenous competing RNAs" revealed recently in animals.These endogenous regulatory mechanisms of "double negatives making a positive" have now been developed into a key strategy in the study of small RNA functions. This review presents some reflections on the long journey to the short tandem target mimic(STTM) for selective destruction/blockage of specific miRNAs in plants and animals,and the potential applications of STTM are discussed.展开更多
The Lead-Bismuth Eutectic(LBE) spallation target has been considered as one of the two alternatives for the spallation target for China Initiative Accelerator-Driven System.This paper reports the preliminary study on ...The Lead-Bismuth Eutectic(LBE) spallation target has been considered as one of the two alternatives for the spallation target for China Initiative Accelerator-Driven System.This paper reports the preliminary study on physical feasibility of a U-type LBE target with window.The simulation results based on Monte Carlo transport code MCNPX indicate that the spallation neutron yield is about 2.5 per proton.The maximum spallation neutron flux is observed at about 3 cm below the lowest part of the window.When the LBE target is coupled with the reactor,the reactor neutrons from the fission reaction increased the neutron field significantly.The energy deposition of highenergy protons is the main heat source;the spallation neutrons and reactor neutrons contribute only a small fraction.The maximum energy deposition in the LBE is about 590 W/cm^3 and that in the target window is about319 W/cm^3.To estimate the lifetime of the target window,we have calculated the radiation damages.The maximum displacement production rate in the target window is about10 dpa/FPY.The hydrogen and helium production rates generated during normal operation were also evaluated.By analyzing the residual nucleus in the target during the steady operation,we estimated the accumulated quantities of the extreme radioactivity toxicant ^(210)Po in the LBE target loop.The results would be helpful for the evaluation of the target behavior and will be beneficial to the optimization of the target design work of the experimental facilities.展开更多
Stroke is usually treated by systemic thrombolytic therapy if the patient presents within an appropriate time window. There is also widespread interest in the development of thrombolytic agents that can be used in cas...Stroke is usually treated by systemic thrombolytic therapy if the patient presents within an appropriate time window. There is also widespread interest in the development of thrombolytic agents that can be used in cases of delayed presentation. Current agents that can be used in cases of delayed presentation of nerve damage by thrombus. Current systemic thrombolytic therapy is associated with adverse effects such as fibrinogenolysis and bleeding. In an attempt to increase the efficacy, safety, and specificity of thrombolytic therapy, a number of targeted thrombolytic agents have been studied in recent years. This review focuses on the concepts underlying targeted thrombolytic therapy and describes recent drug developments in this field.展开更多
An algorithm for detecting moving IR point target in complex background is proposed, which is based on the Reverse Phase Feature of Neighborhood (RPFN) of target in difference between neighbor frame images that two ...An algorithm for detecting moving IR point target in complex background is proposed, which is based on the Reverse Phase Feature of Neighborhood (RPFN) of target in difference between neighbor frame images that two positions of the target in the difference image are near and the gray values of them are close to in absolute value but with inverse sign. Firstly, pairs of points with RPFN are detected in the difference image between neighbor frame images, with which a virtual vector graph is made, and then the moving point target can be detected by the vectors' sequence cumulated in vector graphs. In addition, a theorem for the convergence of detection of target contrail by this algorithm is given and proved so as to afford a solid guarantee for practical applications of the algorithm proposed in this paper. Finally, some simulation results with 1000 frames from 10 typical images in complex background show that moving point targets with SNR not lower than 1.5 can be detected effectively.展开更多
High frequency surface wave radar (HFSWR) is well proved to have over the horizon (OTH) detection capability to weak aerial targets, such as concealed airplanes or cruise missiles. The most important problem of detect...High frequency surface wave radar (HFSWR) is well proved to have over the horizon (OTH) detection capability to weak aerial targets, such as concealed airplanes or cruise missiles. The most important problem of detection of fast and small targets using HFSWR is earlier warning, i.e. enlargement of detection range oftargets. Therefore, the detection threshold should be decreased as low as possible, but numerous false alarms are brought about at the same time. On this condition, conventional track initiation techniques, which normally require the probability of false alarm to be at the level of 10-6, will initiate enormous false tracks and lead to abnormal operation of tracking system. An adaptive modified hough transform (AMHT) track initiator is proposed accordingly and the relation of detection range to the performance of track initiator is analyzed in this paper. Simulations are performed to confirm the capability of track initiation to fast and small targets in dense clutter by AMHT track initiator. The tolerable probability of false alarm of detector can reach the level of 10 -3 . And it performs better than track initiator based on modified hough transform (MHT).展开更多
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the o...The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.展开更多
Target tracking is considered as one of the cardinal applications of a wireless sensor network. Tracking multiple targets is more challenging than tracking a single target in a wireless sensor network due to targets’...Target tracking is considered as one of the cardinal applications of a wireless sensor network. Tracking multiple targets is more challenging than tracking a single target in a wireless sensor network due to targets’ movement in different directions, targets’ speed variations and frequent connectivity failures of low powered sensor nodes. If all the low-powered sensor nodes are kept active in tracking multiple targets coming from different directions of the network, there is high probability of network failure due to wastage of power. It would be more realistic if the tracking area can be reduced so that less number of sensor nodes will be active and therefore, the network will consume less energy. Tracking area can be reduced by using the target’s kinematics. There is almost no method to track multiple targets based on targets’ kinematics. In our paper, we propose a distributed tracking method for tracking multiple targets considering targets’ kinematics. We simulate our method by a sensor network simulator OMNeT++ and empirical results state that our proposed methodology outperforms traditional tracking algorithms.展开更多
To satisfy the demand of measuring the velocity of ground moving target through unmanned aerial vehicle(UAV)electro-optical platform,two velocity measurement methods are proposed.Firstly,a velocity measurement method ...To satisfy the demand of measuring the velocity of ground moving target through unmanned aerial vehicle(UAV)electro-optical platform,two velocity measurement methods are proposed.Firstly,a velocity measurement method based on target localization is derived,using the position difference between two points with the advantages of easy deployment and realization.Then a mathematical model for measuring target velocity is built and described by 15 variables,i.e.UAV velocity,UAV attitude angular rate,camera direction angular rate and so on.Moreover,the causes of velocity measurement error are analyzed and a formula is derived for calculating the measurement error.Finally,the simulation results show that angular rate error has a strong influence on the velocity measurement accuracy,especially the UAV pitch angular rate error,roll angular rate error and the camera angular altitude rate error,thus indicating the direction for improving velocity measurement precision.展开更多
A Target State Estimator (TSE) for airborne radar system is proposed in this paper. It is very important for fire control system to obtain accurate estimation of the maneuvering target and the TSE becomes a key link i...A Target State Estimator (TSE) for airborne radar system is proposed in this paper. It is very important for fire control system to obtain accurate estimation of the maneuvering target and the TSE becomes a key link in the integrated Flight/Fire Control (IFFC) system. By adopting the Cartesian coordinates and pseudomeasurements ,the result ed TSE has it s advantages in computation.In addition, by employing accurate range and range-rate redundant filter, the range direction estimations obtained in Cartesian filter are greatly improved. The TSE shows its satisfaCtory performance in the Monte Carlo simulation of the IFFC system.展开更多
Target tracking is very important in computer vision and related areas. It is usually difficult to accurately track fast motion target with appearance variations. Sometimes the tracking algorithms fail for heavy appea...Target tracking is very important in computer vision and related areas. It is usually difficult to accurately track fast motion target with appearance variations. Sometimes the tracking algorithms fail for heavy appearance variations. A multiple template method to track fast motion target with appearance changes is presented under the framework of appearance model with Kalman filter. Firstly, we construct a multiple template appearance model, which includes both the original template and templates affinely transformed from original one. Generally speaking, appearance variations of fast motion target can be covered by affine transformation. Therefore, the affine tr templates match the target of appearance variations better than conventional models. Secondly, we present an improved Kalman filter for approx- imate estimating the motion trail of the target and a modified similarity evaluation function for exact matching. The estimation approach can reduce time complexity of the algorithm and keep accuracy in the meantime. Thirdly, we propose an adaptive scheme for updating template set to alleviate the drift problem. The scheme considers the following differences: the weight differences in two successive frames; different types of affine transformation applied to templates. Finally, experiments demonstrate that the proposed algorithm is robust to appearance varia- tion of fast motion target and achieves real-time performance on middle/low-range computing platform.展开更多
In order to improve measurement accuracy of moving target signals, an automatic target recognition model of moving target signals was established based on empirical mode decomposition(EMD) and support vector machine(S...In order to improve measurement accuracy of moving target signals, an automatic target recognition model of moving target signals was established based on empirical mode decomposition(EMD) and support vector machine(SVM). Automatic target recognition process on the nonlinear and non-stationary of Doppler signals of military target by using automatic target recognition model can be expressed as follows. Firstly, the nonlinearity and non-stationary of Doppler signals were decomposed into a set of intrinsic mode functions(IMFs) using EMD. After the Hilbert transform of IMF, the energy ratio of each IMF to the total IMFs can be extracted as the features of military target. Then, the SVM was trained through using the energy ratio to classify the military targets, and genetic algorithm(GA) was used to optimize SVM parameters in the solution space. The experimental results show that this algorithm can achieve the recognition accuracies of 86.15%, 87.93%, and 82.28% for tank, vehicle and soldier, respectively.展开更多
文摘This article provides a comprehensive review of various approaches to targeted drug delivery for liver cancer, an area of significant need due to the limited effectiveness of current treatments. The article begins by highlighting the role of the liver in metabolism and discusses the high mortality associated with hepatocellular carcinoma (HCC). The shortcomings of traditional chemotherapy, such as multidrug resistance and off-target effects, necessitate the exploration of novel therapeutic strategies, with a focus on targeted approaches. The review details both passive and active targeting strategies. Passive targeting leverages the enhanced permeability and retention (EPR) effect and unique features of the tumor microenvironment, while active targeting employs specific ligands, such as peptides, antibodies, and proteins, to bind to overexpressed receptors on liver and tumor cells. The article further details many examples of active targeting using the asialoglycoprotein receptor (ASGPR), glycyrrhetinic acid (GA), transferrin receptor (TfR), and folate receptor (FR) on hepatocytes and tumor cells, demonstrating that there has been significant research effort put into this field. The importance of non-parenchymal cells in the liver is also discussed, and the article examines methods of targeting Kupffer cells, sinusoidal endothelial cells, and hepatic stellate cells for therapeutic benefit. The review goes on to cover the emerging field of subcellular targeting, including specific strategies to target the nucleus, mitochondria, and the endoplasmic reticulum/Golgi apparatus, noting that although there has been some progress, further research is needed in this area. The text finishes with a summary which acknowledges that while targeted therapies, including enzyme-activated prodrugs, such as Pradefovir, and other novel methods for drug delivery have shown significant promise, challenges remain in translating these therapies into clinical use due to limitations in understanding the sequential transport and the mechanisms of action. Ultimately, the article emphasizes the need for in-depth research to fully realize the potential of precision cancer therapies for liver cancer.
基金the National Natural Science Foundation of China (Nos. 21705102, 21775096)the Shanxi Province Science Foundation for Youths (No. 201701D221061)+1 种基金Shanxi Province Foundation for Returnees (No. 2017-026)Scientific Instrument Center of Shanxi University (No. 201512)
文摘Hydrogen peroxide(H2 O2), as important products of oxygen metabolism, plays an important role in many biological processes, such as immune responses and cellular signal transduction. However, abnormal production of H2 O2 can damage cellular biomolecules, which was closely associated with many diseases.Thus, it is urgent to monitor the level change of H2 O2 in living cells, particularly at subcellular levels.Toward this end, a wide variety of H2 O2 fluorescent probes have been designed, developed and applied for imaging of H2 O2 in subcellular levels. In this review, we highlight the representative cases of H2 O2 fluorescent probes with mitochondria, nuclei and lysosomes-targetable ability. The review contains organelle target strategies, structures, fluorescence behavior and biological applications of these probes.
基金Supported by The National Institutes of Health National Cancer Institute(Grants EDRN CA111294,and SPORE CA127297)
文摘Cutaneous malignant melanoma is the most aggressive form of skin cancer with an extremely poor survival rate for the patients diagnosed with locally invasive and metastatic disease states. Intensive research has led in last few years to an improvement of the early detection and curative treatment of primary cutaneous melanomas that are confined to the skin by tumor surgical resection. However, locally advanced and disseminated melanomas are generally resistant to conventional treatments, including ionizing radiation, systemic chemotherapy, immunotherapy and/or adjuvant stem cellbased therapies, and result in the death of patients. The rapid progression of primary melanomas to locally invasive and/or metastatic disease states remains a major obstacle for an early effective diagnosis and a curative therapeutic intervention for melanoma patients. Importantly, recent advances in the melanoma research have led to the identification of different gene products that are often implicated in the malignant transforma-tion of melanocytic cells into melanoma cells, including melanoma stem/progenitor cells, during melanoma initiation and progression to locally advanced and metastatic disease states. The frequent deregulated genes products encompass the oncogenic B-Raf V600 E and N-RasQ 61 R mutants, different receptor tyrosine kinases and developmental pathways such as epidermal growth factor receptor(EGFR), stem cell-like factor(SCF) receptor KIT, hedgehog, Wnt/β-catenin, Notch, stromal cell-derived factor-1(SDF-1)/CXC chemokine receptor-4(CXCR4) and vascular endothelial growth factor(VEGF)/VEGFR receptor. These growth factors can cooperate to activate distinct tumorigenic downstream signaling elements and epithelial-mesenchymal transition(EMT)-associated molecules, including phosphatidylinositol 3'-kinase(PI3K)/Akt/ molecular target of rapamycin(mT OR), nuclear factor-kappaB(NF-κB), macrophage inhibitory cytokine-1(MIC-1), vimentin, snail and twist. Of therapeutic relevance, these deregulated signal transduction components constitute new potential biomarkers and therapeutic targets of great clinical interest for improving the efficacy of current diagnostic and prognostic methods and management of patients diagnosed with locally advanced, metastatic and/or relapsed melanomas.
基金The project supported by National Natural Science Foundation of China(81300964)the China Postdoctoral Science Foundation(2013M531611,2014T70648)
文摘Bone tumour is one of most common primary cancer which exhibits cancerous osteoblastic differentiation and malignant osteoid in patients.At present,chemotherapy(pre-and post-operative)is used as a standard treatment protocol for bone tumour.However,drugs used in the treatment of bone tumour induce high toxicity to normal tissues including anaemia,neutropenia,thrombocytopenia,and heart damage which further reduce the survival rate of patients.Therefore,there is an urgent need to develop a new therapeutic approach for the treatment such that it induce maximum cell killing effect in tumor cells while sparing the healthy bone cells.In this article,some new perspectives were provided on the development of bone-targeted nano-drug carriers for bone cancer treatment.We hope such discussions wouldencourage more detailed and careful studies to support product development of bone-targeted drug carriers for bone cancer treatment.
文摘Lung cancer is responsible for 29% of cancer deaths in the United States and has very low 5-year survival rates of approximately 11% in men and 15% in women.Although the early diagnosis of lung cancer may increase the survival rate with adequate treatment,advanced lung cancers are often metastasized and receive limited benefit from therapeutic regimens.As conventional treatments for lung cancer reach their limitations,researchers have attempted to discover novel drug therapies aimed at specific targets contributing to the progression of tumorigenesis.Recent advances in systems biology have enabled the molecular biology of lung carcinogenesis to be elucidated.Our understanding of the physiologic processes of tumor development provide a means to design more effective and specific drugs with less toxicity,thereby accelerating the delivery of new drug therapies to the patient's bedside.
文摘In multiple extended targets tracking, replacing traditional multiple measurements with a rectangular region of the nonzero volume in the state space inspired by the box-particle idea is exactly suitable to deal with extended targets, without distinguishing the measurements originating from the true targets or clutter.Based on our recent work on extended box-particle probability hypothesis density(ET-BP-PHD) filter, we propose the extended labeled box-particle cardinalized probability hypothesis density(ET-LBP-CPHD) filter, which relaxes the Poisson assumptions of the extended target probability hypothesis density(PHD) filter in target numbers, and propagates not only the intensity function but also cardinality distribution. Moreover, it provides the identity of individual target by adding labels to box-particles. The proposed filter can improve the precision of estimating target number meanwhile achieve targets' tracks. The effectiveness and reliability of the proposed algorithm are verified by the simulation results.
基金Work done in Guiliang Tang's lab was supported,in whole or in part,by USDA National Research Initiative grants(2006- 35301-17115 and 2006-35100-17433)the National Science Foundation grants(MCB-0718029:Subaward No.S-00000260 and IOS-1048216/IOS-1219316)+1 种基金the startup of Michigan Technological UniversityWork done in Xiaoqing Tang's lab was supported in part by the National Institutes of Health(K01 DK078648 and R03 DK084166)
文摘MicroRNAs(miRNAs) are a population of highly conserved specific small ribo-regulators that negatively regulate gene expressions in both plants and animals.They play a key role in post-transcriptional gene regulation by destabilizing the target gene transcripts or blocking protein translation from them.Interestingly,these negative regulators are largely compromised by an upstream layer of negative regulators "target mimics" found in plants or "endogenous competing RNAs" revealed recently in animals.These endogenous regulatory mechanisms of "double negatives making a positive" have now been developed into a key strategy in the study of small RNA functions. This review presents some reflections on the long journey to the short tandem target mimic(STTM) for selective destruction/blockage of specific miRNAs in plants and animals,and the potential applications of STTM are discussed.
基金supported by Strategic Priority Research Program of Chinese Academy of Sciences under Grant Number of XDA03030102
文摘The Lead-Bismuth Eutectic(LBE) spallation target has been considered as one of the two alternatives for the spallation target for China Initiative Accelerator-Driven System.This paper reports the preliminary study on physical feasibility of a U-type LBE target with window.The simulation results based on Monte Carlo transport code MCNPX indicate that the spallation neutron yield is about 2.5 per proton.The maximum spallation neutron flux is observed at about 3 cm below the lowest part of the window.When the LBE target is coupled with the reactor,the reactor neutrons from the fission reaction increased the neutron field significantly.The energy deposition of highenergy protons is the main heat source;the spallation neutrons and reactor neutrons contribute only a small fraction.The maximum energy deposition in the LBE is about 590 W/cm^3 and that in the target window is about319 W/cm^3.To estimate the lifetime of the target window,we have calculated the radiation damages.The maximum displacement production rate in the target window is about10 dpa/FPY.The hydrogen and helium production rates generated during normal operation were also evaluated.By analyzing the residual nucleus in the target during the steady operation,we estimated the accumulated quantities of the extreme radioactivity toxicant ^(210)Po in the LBE target loop.The results would be helpful for the evaluation of the target behavior and will be beneficial to the optimization of the target design work of the experimental facilities.
基金supported by the National Natural Science Foundation of China,No.81271692
文摘Stroke is usually treated by systemic thrombolytic therapy if the patient presents within an appropriate time window. There is also widespread interest in the development of thrombolytic agents that can be used in cases of delayed presentation. Current agents that can be used in cases of delayed presentation of nerve damage by thrombus. Current systemic thrombolytic therapy is associated with adverse effects such as fibrinogenolysis and bleeding. In an attempt to increase the efficacy, safety, and specificity of thrombolytic therapy, a number of targeted thrombolytic agents have been studied in recent years. This review focuses on the concepts underlying targeted thrombolytic therapy and describes recent drug developments in this field.
文摘An algorithm for detecting moving IR point target in complex background is proposed, which is based on the Reverse Phase Feature of Neighborhood (RPFN) of target in difference between neighbor frame images that two positions of the target in the difference image are near and the gray values of them are close to in absolute value but with inverse sign. Firstly, pairs of points with RPFN are detected in the difference image between neighbor frame images, with which a virtual vector graph is made, and then the moving point target can be detected by the vectors' sequence cumulated in vector graphs. In addition, a theorem for the convergence of detection of target contrail by this algorithm is given and proved so as to afford a solid guarantee for practical applications of the algorithm proposed in this paper. Finally, some simulation results with 1000 frames from 10 typical images in complex background show that moving point targets with SNR not lower than 1.5 can be detected effectively.
文摘High frequency surface wave radar (HFSWR) is well proved to have over the horizon (OTH) detection capability to weak aerial targets, such as concealed airplanes or cruise missiles. The most important problem of detection of fast and small targets using HFSWR is earlier warning, i.e. enlargement of detection range oftargets. Therefore, the detection threshold should be decreased as low as possible, but numerous false alarms are brought about at the same time. On this condition, conventional track initiation techniques, which normally require the probability of false alarm to be at the level of 10-6, will initiate enormous false tracks and lead to abnormal operation of tracking system. An adaptive modified hough transform (AMHT) track initiator is proposed accordingly and the relation of detection range to the performance of track initiator is analyzed in this paper. Simulations are performed to confirm the capability of track initiation to fast and small targets in dense clutter by AMHT track initiator. The tolerable probability of false alarm of detector can reach the level of 10 -3 . And it performs better than track initiator based on modified hough transform (MHT).
基金supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001)the National Natural Science Foundation of China (81471001)the Inner Mongolia Science and Technology Program, China (201502073)
文摘The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of g RNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp g RNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using g RNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively;rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively;all were 0% at the Off-MSTN-2 locus;rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp g RNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
文摘Target tracking is considered as one of the cardinal applications of a wireless sensor network. Tracking multiple targets is more challenging than tracking a single target in a wireless sensor network due to targets’ movement in different directions, targets’ speed variations and frequent connectivity failures of low powered sensor nodes. If all the low-powered sensor nodes are kept active in tracking multiple targets coming from different directions of the network, there is high probability of network failure due to wastage of power. It would be more realistic if the tracking area can be reduced so that less number of sensor nodes will be active and therefore, the network will consume less energy. Tracking area can be reduced by using the target’s kinematics. There is almost no method to track multiple targets based on targets’ kinematics. In our paper, we propose a distributed tracking method for tracking multiple targets considering targets’ kinematics. We simulate our method by a sensor network simulator OMNeT++ and empirical results state that our proposed methodology outperforms traditional tracking algorithms.
基金supported by the Aeronautical Science Foundation of China(No.61106018)
文摘To satisfy the demand of measuring the velocity of ground moving target through unmanned aerial vehicle(UAV)electro-optical platform,two velocity measurement methods are proposed.Firstly,a velocity measurement method based on target localization is derived,using the position difference between two points with the advantages of easy deployment and realization.Then a mathematical model for measuring target velocity is built and described by 15 variables,i.e.UAV velocity,UAV attitude angular rate,camera direction angular rate and so on.Moreover,the causes of velocity measurement error are analyzed and a formula is derived for calculating the measurement error.Finally,the simulation results show that angular rate error has a strong influence on the velocity measurement accuracy,especially the UAV pitch angular rate error,roll angular rate error and the camera angular altitude rate error,thus indicating the direction for improving velocity measurement precision.
文摘A Target State Estimator (TSE) for airborne radar system is proposed in this paper. It is very important for fire control system to obtain accurate estimation of the maneuvering target and the TSE becomes a key link in the integrated Flight/Fire Control (IFFC) system. By adopting the Cartesian coordinates and pseudomeasurements ,the result ed TSE has it s advantages in computation.In addition, by employing accurate range and range-rate redundant filter, the range direction estimations obtained in Cartesian filter are greatly improved. The TSE shows its satisfaCtory performance in the Monte Carlo simulation of the IFFC system.
基金Supported by the National Science Foundation of China(61472289)Hubei Province Science Foundation(2015CFB254)
文摘Target tracking is very important in computer vision and related areas. It is usually difficult to accurately track fast motion target with appearance variations. Sometimes the tracking algorithms fail for heavy appearance variations. A multiple template method to track fast motion target with appearance changes is presented under the framework of appearance model with Kalman filter. Firstly, we construct a multiple template appearance model, which includes both the original template and templates affinely transformed from original one. Generally speaking, appearance variations of fast motion target can be covered by affine transformation. Therefore, the affine tr templates match the target of appearance variations better than conventional models. Secondly, we present an improved Kalman filter for approx- imate estimating the motion trail of the target and a modified similarity evaluation function for exact matching. The estimation approach can reduce time complexity of the algorithm and keep accuracy in the meantime. Thirdly, we propose an adaptive scheme for updating template set to alleviate the drift problem. The scheme considers the following differences: the weight differences in two successive frames; different types of affine transformation applied to templates. Finally, experiments demonstrate that the proposed algorithm is robust to appearance varia- tion of fast motion target and achieves real-time performance on middle/low-range computing platform.
基金Projects(61471370,61401479)supported by the National Natural Science Foundation of China
文摘In order to improve measurement accuracy of moving target signals, an automatic target recognition model of moving target signals was established based on empirical mode decomposition(EMD) and support vector machine(SVM). Automatic target recognition process on the nonlinear and non-stationary of Doppler signals of military target by using automatic target recognition model can be expressed as follows. Firstly, the nonlinearity and non-stationary of Doppler signals were decomposed into a set of intrinsic mode functions(IMFs) using EMD. After the Hilbert transform of IMF, the energy ratio of each IMF to the total IMFs can be extracted as the features of military target. Then, the SVM was trained through using the energy ratio to classify the military targets, and genetic algorithm(GA) was used to optimize SVM parameters in the solution space. The experimental results show that this algorithm can achieve the recognition accuracies of 86.15%, 87.93%, and 82.28% for tank, vehicle and soldier, respectively.