Lipoxygenase (LOX, EC1.13.11.12) is a key enzyme during the degradation of lipids in animals and even plants, and also the first key enzyme responsible for the biosynthesis of jasmonate. To purify and characterize t...Lipoxygenase (LOX, EC1.13.11.12) is a key enzyme during the degradation of lipids in animals and even plants, and also the first key enzyme responsible for the biosynthesis of jasmonate. To purify and characterize the OsLOX1 gene from rice seeds, the entire coding region of the OsLOX1 gene was inserted into an expression vector pET30a(+) and transformed into Escherichia coil BL21 (DE3). Expression of the fusion protein was successfully induced by isopropyl-β-D- thiogalactopyranoside (IPTG) and the purified recombinant protein was obtained by His.Bind Kits. Further assay showed that the purified recombinant protein exhibited the LOX activity. The optimum pH was 4.8 (acetate buffer) and the optimum temperature was 30℃ for the above enzyme. Thus, the recombinant might confer an available usage for the synthesis of jasmonate in vitro, and also provides a possibility for elucidating the inter-relationship between the primary structure of the plant seed lipoxygenase protein and its physiological functions.展开更多
With the use of a seed washing technique, more than 4000 Gram negative bacteria were isolated by two improved isolation methods from 446 batches of 1 kg rice seed samples obtained from 22 provinces in the Philippines....With the use of a seed washing technique, more than 4000 Gram negative bacteria were isolated by two improved isolation methods from 446 batches of 1 kg rice seed samples obtained from 22 provinces in the Philippines. They were initially characterized on the basis of colony morphology and results of biochemical and pathogenicity tests. Six hundred and fifty two strains were further identified by Biolog, from which 133 were selected for fatty acid methyl ester (FAME) analysis together with 80 standard reference!strains. Sixteen species or types of Pseudomonas and 17 genera of non pseudomonads were identified, more than one third of which have not been recorded in rice. The most predominant species observed were P. putida and P. fulva. About 17% of the strains of Pseudomonas and 2% of the non pseudomonads were antagonistic to one or more fungal or bacterial pathogens of rice. Rice seed is an important source of biological control agents.展开更多
Ultraweak chemiluminescence(UCL)is the sponta-neous light emission radiated from various biological sys-tems derived from chemiexcitation of biological molecules during oxidative metabolicprocesses(Popp et al,1988).Th...Ultraweak chemiluminescence(UCL)is the sponta-neous light emission radiated from various biological sys-tems derived from chemiexcitation of biological molecules during oxidative metabolicprocesses(Popp et al,1988).Therefore,this weak light is a possible representation of physiological or pathological conditions of cells and tis-sues.Detection of UCL makes it possible to acquire im-mediate information on biological activities non-invasively(Popp et al,1988).The most important aspect of the chemiluminescence(CL)in biological systems is that it gives readily detectable,continuously monitorable,non-invasive signals of oxidative metabolism.展开更多
A machine vision system was developed to inspect the quality of rice seeds. Five varieties of Jinyou402, Shanyou10, Zhongyou207, Jiayou and IIyou were evaluated. The images of both sides of rice seed with black backg...A machine vision system was developed to inspect the quality of rice seeds. Five varieties of Jinyou402, Shanyou10, Zhongyou207, Jiayou and IIyou were evaluated. The images of both sides of rice seed with black background and white background were acquired with the image processing system for identifying external features of rice seeds. Five image sets consisting of 600 original images each were obtained. Then a digital image processing algorithm based on Hough transform was developed to inspect the rice seeds with incompletely closed glumes. The algorithm was implemented with all image sets using a Matlab 6.5 procedure. The results showed that the algorithm achieved an average accuracy of 96% for normal seeds, 92% for seeds with fine fissure and 87% for seeds with incompletely closed glumes. The algorithm was proved to be applicable to different seed varieties and insensitive to the color of the background.展开更多
A survey on isolation and detection of the casual organism of bacterial grain rot of rice was conducted during 1997-2006. In 2006, six pathogenic bacterial strains were isolated from two symptomless seed samples of ri...A survey on isolation and detection of the casual organism of bacterial grain rot of rice was conducted during 1997-2006. In 2006, six pathogenic bacterial strains were isolated from two symptomless seed samples of rice (Oryza sativa L.) originally produced in Hainan Province and then planted in Zhejiang Province, China. They were identified as Burkholderia glumae which is the causal organism of bacterial grain rot of rice by physiological characteristics, colony morphology, pathogenicity test, Biolog, fatty acid methyl ester (FAME) analysis and RAPD-PCR compared with the four standard reference strains. It is confirmed that there is the infection of B. glumae in so-called 'health looking seeds'.展开更多
A digital image analysis algorithm based color and morphological features was developed to identify the six varieties (ey7954, syz3, xsl 1, xy5968, xy9308, z903) rice seeds which are widely planted in Zhejiang Provi...A digital image analysis algorithm based color and morphological features was developed to identify the six varieties (ey7954, syz3, xsl 1, xy5968, xy9308, z903) rice seeds which are widely planted in Zhejiang Province. Seven color and fourteen morphological features were used for discriminant analysis, Two hundred and forty kernels used as the training data set and sixty kernels as the test data set in the neural network used to identify rice seed varieties. When the model was tested on the test data set, the identification accuracies were 90.00%, 88.00%, 95.00%, 82.00%, 74.00%, 80.00% for ey7954, syz3, xsl1, xy5968, xy9308, z903 respectively.展开更多
We developed a computerized seed identification system. Fifteen rice varietiesthat were widely used in China were analyzed by AFLP fingerprinting. 12 primerpairs were screened, In order to simplify the procedure and c...We developed a computerized seed identification system. Fifteen rice varietiesthat were widely used in China were analyzed by AFLP fingerprinting. 12 primerpairs were screened, In order to simplify the procedure and cut down the cost inseed identification. the least number of primer pairs for practical seed identifi-cation should be seleeled. In this study. 3 primer pairs were selected. They展开更多
The effect of La(NO3)(3) on natural or artificial aged rice seeds vigor was studied. The results show that the germination rate, germination index and vigor index of aged rice seed increase. Activities of superoxide d...The effect of La(NO3)(3) on natural or artificial aged rice seeds vigor was studied. The results show that the germination rate, germination index and vigor index of aged rice seed increase. Activities of superoxide dismutase, catalase and peroxidase are enhanced. . O-2(-) and malond ialdehyde contents decrease in germinating stage of aged rice seed, and cell membrane permeability of aged rice seeds reduces by treating with La(NO3)(3). The vigor increase of rice natural aged seed is greater than that of artificial aged rice seeds by treating with La(NO3)(3).展开更多
The relation between seed viability and waterstatus in seed was studied.The experimentwas carried out at Zhongshan University.Seeds of hybrid rice Shanyou 63 were collectedfrom Guangdong Academy of Agriculture Sci-enc...The relation between seed viability and waterstatus in seed was studied.The experimentwas carried out at Zhongshan University.Seeds of hybrid rice Shanyou 63 were collectedfrom Guangdong Academy of Agriculture Sci-ences in 1993 and then stored for one year inopen air or with silica gel.Before and afterstorage,the relative content of free water andbound water in seeds were measured with展开更多
Seeds of japonica rice (cv. Zhenuo 2) at twodifferent physiological states (dry seeds withwater content 13% and wet seeds soaked inthe water for 36 h) were irradiated by COlaser in four different power-densities. Thes...Seeds of japonica rice (cv. Zhenuo 2) at twodifferent physiological states (dry seeds withwater content 13% and wet seeds soaked inthe water for 36 h) were irradiated by COlaser in four different power-densities. Theseeds irradiated by 200GY ofCo γ rays andno radiated seeds were used as the controls.Results showed that the biological effects展开更多
Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far...Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as展开更多
Incompletely closed glumes, germination on panicle and disease are three important factors causing poor seed quality of hybrid rice. To determine how many and which categories should be classified to meet the demand f...Incompletely closed glumes, germination on panicle and disease are three important factors causing poor seed quality of hybrid rice. To determine how many and which categories should be classified to meet the demand for seed in rice production, the effects of various degrees of incompletely closed glumes, germination on panicle and disease on germination percentage at the harvest and after storage for six months were studied by standard germination percentage test. Six categories of seeds with germ (germinated seeds), severe disease, incompletely closed glumes, spot disease, fine fissure and normal seeds were inspected and then treated separately. Images of the five hybrid rice seed (Jinyou 402, Shanyou 10, Zhongyou 27, Jiayou 99 and Ⅱ you 3207) were acquired with a self-developed machine vision system. Each image could be processed to get the feature values of seed region such as length, width, ratio of length to width, area, solidity and hue. Then all the images of normal seeds were calculated to draw the feature value ranges of each hybrid rice variety. Finally, an image information base that stores typical images and related feature values of each variety was established. This image information base can help us to identify the classification limit of characteristics, and provide the reference of the threshold selection. The management of large numbers of pictures and the addition of new varieties have been supported. The research laid a foundation for extracting image features of hybrid rice seed, which is a key approach to future quality inspection with machine vision.展开更多
In this study,two indica varieties with different dormancy characteristics [4 K58( II-32 B dormant),4 K59( II-32 B) ] and their F2 seeds( C178,C179) obtained through hybridization with sterile line( II-32 A) were used...In this study,two indica varieties with different dormancy characteristics [4 K58( II-32 B dormant),4 K59( II-32 B) ] and their F2 seeds( C178,C179) obtained through hybridization with sterile line( II-32 A) were used as materials. Different aged seeds( 0,3,6 and 9 d) of these four varieties were acquired by artificial accelerated aging method. Effects of artificial aging on malondialdehyde( MDA) content and catalase( CAT),ascorbate peroxidase( APX),peroxidase( POD) and superoxide dismutase( SOD) activity were investigated. The results showed that with the prolongation of aging time,MDA contents of these four rice varieties increased significantly,while the activity of antioxidant enzymes decreased dramatically. Besides,MDA contents and SOD,CAT and APX activity of the two inbred lines were significantly lower than those of the hybrid varieties. In addition,the activity of antioxidant enzymes in 4 K58 and C178 was significantly lower than that in 4 K59 and C179,respectively. This study indicated that artificial aging treatment significantly inhibited the activity of antioxidant system in seeds,improved membrane lipid peroxidation degree,and thus aggravated the deterioration of seeds. In addition,it also suggested that rice seeds with dormant property were more intolerant to storage.展开更多
To better understand the effect and mechanism of cold tolerant seed-coating agents on the cold tolerance of rice seedlings, the physiological and biochemical effects of four cold tolerant seed-coating agents (HET, YK...To better understand the effect and mechanism of cold tolerant seed-coating agents on the cold tolerance of rice seedlings, the physiological and biochemical effects of four cold tolerant seed-coating agents (HET, YKJ, YKZYJ, and the ABA seed coating agents) on two early indica rice varieties were studied under chilling stress. The results showed that the rice seedlings treated with cold tolerant seed-coating agents under chilling stress maintained dramatically higher root vigor, POD, CAT and SOD activities, and chlorophyll content, had lower MDA content and electrolyte leakage, and accumulated more soluble sugar and free proline, when compared with the control without the treatment, and finally showed lower plant injury rate. It was indicated that the cold tolerant seed coating agent improved the ability of rice seedlings in resisting to chilling stress. YKZYJ was ranked the first in terms of the efficiency in cold tolerance among the four cold tolerant seed-coating agents tested.展开更多
We studied the influence of seed priming with beta-amino butyric acid(BABA) on the growth, physiological and biochemical parameters of seedlings with varied abiotic stress tolerance, which were raised and grown unde...We studied the influence of seed priming with beta-amino butyric acid(BABA) on the growth, physiological and biochemical parameters of seedlings with varied abiotic stress tolerance, which were raised and grown under unstressed and stressed(NaCl/PEG-6000) conditions. Under stressed conditions, the growth of rice seedlings was less when compared to control plants. After BABA priming, the seedling growth increased both under unstressed and stressed conditions as compared to the respective controls. BABA priming of rice seeds caused increase in the photosynthetic pigment content of the leaves, modified the chlorophyll a fluorescence related parameters and also enhanced the photosystem activities of seedlings when compared to their respective non-primed controls. BABA priming also caused increased mitochondrial activities of the rice seedlings. Moreover, BABA priming significantly reduced malondialdehyde content in the seedlings and also resulted in accumulation of proline especially in the NaCl tolerant variety Vyttila 6. BABA seed priming also enhanced the activity of nitrate reductase enzyme and activities of antioxidant enzymes like guaiacol peroxidase and superoxide dismutase. The presence of BABA was detected by high performance thin layer chromatography analysis in the rice seeds whereas in the seedlings it was not detected. Thus, it can be inferred that the seed priming effect of BABA mainly occurred within the seeds, which was further carried to the seedlings. It is concluded that BABA priming of seeds improved the drought and salinity stress tolerance of all the three rice varieties and it was significantly evident in the drought tolerant variety Vaisakh and NaCl tolerant variety Vyttila 6, when compared to the stress sensitive variety Neeraja.展开更多
Germination and hydroponic experiments are performed on rice seeds growing in soils treated with Cd stress,with rice seeds of the same variety that is not treated with Cd stress as a control,to study the effects of Cd...Germination and hydroponic experiments are performed on rice seeds growing in soils treated with Cd stress,with rice seeds of the same variety that is not treated with Cd stress as a control,to study the effects of Cd stress on quality of rice seeds.The results have shown that:(1)Cd stress reduces the thousand grain weight of rice seeds,and higher Cd content means lower thousand grain weight;(2)The germination vigor and germination percentage of rice seeds under Cd stress as well as theirα-amylase activity andβ-amylase activity are all lower than those of the control.They decreases as the Cd stress increases;(3)For rice seeds under Cd stress,the height,fresh and dry weight of seedlings,as well as the chlorophyll content,photosynthetic rate and content of soluble protein of their leaves are all lower than those of the control.This indicates that Cd stress has certain effects on the germination and growth of the rice seeds.展开更多
In the economic new normal,production of hybrid rice seed in foreign countries is the necessity for reducing farmland area occupied by seed production,for ensuring national grain security,realizing cost reducing and q...In the economic new normal,production of hybrid rice seed in foreign countries is the necessity for reducing farmland area occupied by seed production,for ensuring national grain security,realizing cost reducing and quality improving of hybrid rice seed,strengthening competitive power at international market,guiding seed industry of China to go out,building transnational seed groups with core competitive power,establishing close relationship with developing countries,promoting the construction of One Belt One Road strategy,serving overall situation of diplomacy,and setting up excellent international image. It is feasible to produce hybrid seed in foreign countries considering( i) high overall national strength of China,( ii) rapid and healthy growth of China's seed industry and increasingly mature hybrid rice seed production technologies,( iii) excellent climatic conditions of foreign host countries of seed production,and( iv) low land and labor price of foreign host countries of seed production. However,there are social and policy risks,technology and trade barrier risks,market,production,and other risks for production of hybrid rice seed in foreign countries. In view of these,it came up with recommendations,including allowing delivering parent seeds of hybrid rice to foreign countries,allowing delivering hybrid rice seed to China,solving the problem of " opening in protection,and protection in opening",and formulating a package of support policies.展开更多
To study the production technology of rice seeds,with Lianjing 7 as test material,this paper explores the effects of the key rice seed production,processing and storage technologies( such as nitrogen fertilizer applic...To study the production technology of rice seeds,with Lianjing 7 as test material,this paper explores the effects of the key rice seed production,processing and storage technologies( such as nitrogen fertilizer application and management,weeding mode in seed breeding field,temperature control of mechanical drying and water control on seed storage) on the quality of rice seeds. The results show that the optimal application proportion of tillering stage dressing and earing fertilizer is 8: 2,followed by 7 : 3; the best time of weeding is booting stage,with the highest purity; the effect of drying and germination rate is best when the temperature is controlled at 44℃ in mechanical drying process; the seed storage quality and storage costs can be guaranteed when the water content of rice seed is controlled at 18%.展开更多
In this study, 151 households were randomly drawn from three randomly selected Kebele in probability proportional to size method. The demographic and socio-economic factors that determine the participation in improved...In this study, 151 households were randomly drawn from three randomly selected Kebele in probability proportional to size method. The demographic and socio-economic factors that determine the participation in improved varieties were household labor availability, education level of the household head,land holdings, distance to the nearest village market, proximity to the main market, and distance to access agricultural extension and access to the source of rice seeds. However, determinants of choice decision varied from cultivar to cultivar. The evidence of the study from the interdependence among the decision of adoption of improved rice varieties suggested that technology adoption will be accelerated by launching a progressively developing package and scheme of rice technology generation, and points to the importance of mobilising additional resources to augment households' efforts at popularization and promotion of improved rice cultivars.The findings from Linearized Almost Ideal Demand Systems(LA/AIDS) model showed that compelling evidence for small proportion changes in own prices and cross price of improved rice varieties led to greater than unitary proportionate changes in their purchases. The results generally showed that farmers were very sensitive to changes in improved rice seed prices and incomes. The major implication of the findings was that any intervention to improve farmers' seed purchases should take into account efforts to increase farmers' purchasing power of agricultural inputs like improved seeds and fertilizers.展开更多
The critical node(CN) is an important stage during seed aging, which is related to effective genebank conservation. Previous studies have demonstrated that proteins undergo carbonylated modification at the CN in rice,...The critical node(CN) is an important stage during seed aging, which is related to effective genebank conservation. Previous studies have demonstrated that proteins undergo carbonylated modification at the CN in rice, indicating oxidative damage. However, the levels of reactive carbonyl species(RCS) and the associated scavenging system at the CN are largely unknown. In this study, we optimized methods for the extraction and analysis of RCS from dry rice embryos. In order to acquire seeds at the CN, rice seeds were subjected to natural conditions for 7, 9, 11 and 13 months, and the seed germination rates were reduced to 90%, 82%, 71% and 57%, respectively. We chose the stage with seed germination rate of 82% as the CN according to the rice seed vigor loss curve. The levels of crotonaldehyde and 4-hydroxy-(E)-2-nonenal(HNE) were significantly increased at the CN. In addition, genes encoding carbonyl-scavenging enzyme, including Os ALDHs and Os AKRs, were significantly down-regulated at the CN, and reductions in the expression of Os ALDH2-2, Os ALDH2-5, Os ALDH3-4, Os ALDH7, Os AKR1 and Os AKR2 in particular could be responsible for RCS accumulation. Thus, the accumulations of crotonaldehyde and HNE and down-regulation of genes encoding carbonyl-scavenging enzyme might be related to an accelerating loss of seed viability at the CN.展开更多
基金grants from the National Basic Research Program of China (Grant No. 2004CB2117204)the National High-tech Research and Development Program of China (Grant No. 2006AA100101)+1 种基金the National Program of Science Technology and Tackle Key Problem of Chinathe Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT) of China
文摘Lipoxygenase (LOX, EC1.13.11.12) is a key enzyme during the degradation of lipids in animals and even plants, and also the first key enzyme responsible for the biosynthesis of jasmonate. To purify and characterize the OsLOX1 gene from rice seeds, the entire coding region of the OsLOX1 gene was inserted into an expression vector pET30a(+) and transformed into Escherichia coil BL21 (DE3). Expression of the fusion protein was successfully induced by isopropyl-β-D- thiogalactopyranoside (IPTG) and the purified recombinant protein was obtained by His.Bind Kits. Further assay showed that the purified recombinant protein exhibited the LOX activity. The optimum pH was 4.8 (acetate buffer) and the optimum temperature was 30℃ for the above enzyme. Thus, the recombinant might confer an available usage for the synthesis of jasmonate in vitro, and also provides a possibility for elucidating the inter-relationship between the primary structure of the plant seed lipoxygenase protein and its physiological functions.
文摘With the use of a seed washing technique, more than 4000 Gram negative bacteria were isolated by two improved isolation methods from 446 batches of 1 kg rice seed samples obtained from 22 provinces in the Philippines. They were initially characterized on the basis of colony morphology and results of biochemical and pathogenicity tests. Six hundred and fifty two strains were further identified by Biolog, from which 133 were selected for fatty acid methyl ester (FAME) analysis together with 80 standard reference!strains. Sixteen species or types of Pseudomonas and 17 genera of non pseudomonads were identified, more than one third of which have not been recorded in rice. The most predominant species observed were P. putida and P. fulva. About 17% of the strains of Pseudomonas and 2% of the non pseudomonads were antagonistic to one or more fungal or bacterial pathogens of rice. Rice seed is an important source of biological control agents.
文摘Ultraweak chemiluminescence(UCL)is the sponta-neous light emission radiated from various biological sys-tems derived from chemiexcitation of biological molecules during oxidative metabolicprocesses(Popp et al,1988).Therefore,this weak light is a possible representation of physiological or pathological conditions of cells and tis-sues.Detection of UCL makes it possible to acquire im-mediate information on biological activities non-invasively(Popp et al,1988).The most important aspect of the chemiluminescence(CL)in biological systems is that it gives readily detectable,continuously monitorable,non-invasive signals of oxidative metabolism.
基金Project supported by the National Natural Science Foundation ofChina (No. 60008001) and the Natural Science Foundation of Zhe-jiang Province (No. 300297), China
文摘A machine vision system was developed to inspect the quality of rice seeds. Five varieties of Jinyou402, Shanyou10, Zhongyou207, Jiayou and IIyou were evaluated. The images of both sides of rice seed with black background and white background were acquired with the image processing system for identifying external features of rice seeds. Five image sets consisting of 600 original images each were obtained. Then a digital image processing algorithm based on Hough transform was developed to inspect the rice seeds with incompletely closed glumes. The algorithm was implemented with all image sets using a Matlab 6.5 procedure. The results showed that the algorithm achieved an average accuracy of 96% for normal seeds, 92% for seeds with fine fissure and 87% for seeds with incompletely closed glumes. The algorithm was proved to be applicable to different seed varieties and insensitive to the color of the background.
基金the National Natural Science Foundation of China (Grant No. 30671397)
文摘A survey on isolation and detection of the casual organism of bacterial grain rot of rice was conducted during 1997-2006. In 2006, six pathogenic bacterial strains were isolated from two symptomless seed samples of rice (Oryza sativa L.) originally produced in Hainan Province and then planted in Zhejiang Province, China. They were identified as Burkholderia glumae which is the causal organism of bacterial grain rot of rice by physiological characteristics, colony morphology, pathogenicity test, Biolog, fatty acid methyl ester (FAME) analysis and RAPD-PCR compared with the four standard reference strains. It is confirmed that there is the infection of B. glumae in so-called 'health looking seeds'.
基金Project supported by the National Natural Science Foundation of China (No. 60008001) and the Natural Science Foundation ofZhejiang Province, China (No. 300297)
文摘A digital image analysis algorithm based color and morphological features was developed to identify the six varieties (ey7954, syz3, xsl 1, xy5968, xy9308, z903) rice seeds which are widely planted in Zhejiang Province. Seven color and fourteen morphological features were used for discriminant analysis, Two hundred and forty kernels used as the training data set and sixty kernels as the test data set in the neural network used to identify rice seed varieties. When the model was tested on the test data set, the identification accuracies were 90.00%, 88.00%, 95.00%, 82.00%, 74.00%, 80.00% for ey7954, syz3, xsl1, xy5968, xy9308, z903 respectively.
文摘We developed a computerized seed identification system. Fifteen rice varietiesthat were widely used in China were analyzed by AFLP fingerprinting. 12 primerpairs were screened, In order to simplify the procedure and cut down the cost inseed identification. the least number of primer pairs for practical seed identifi-cation should be seleeled. In this study. 3 primer pairs were selected. They
文摘The effect of La(NO3)(3) on natural or artificial aged rice seeds vigor was studied. The results show that the germination rate, germination index and vigor index of aged rice seed increase. Activities of superoxide dismutase, catalase and peroxidase are enhanced. . O-2(-) and malond ialdehyde contents decrease in germinating stage of aged rice seed, and cell membrane permeability of aged rice seeds reduces by treating with La(NO3)(3). The vigor increase of rice natural aged seed is greater than that of artificial aged rice seeds by treating with La(NO3)(3).
文摘The relation between seed viability and waterstatus in seed was studied.The experimentwas carried out at Zhongshan University.Seeds of hybrid rice Shanyou 63 were collectedfrom Guangdong Academy of Agriculture Sci-ences in 1993 and then stored for one year inopen air or with silica gel.Before and afterstorage,the relative content of free water andbound water in seeds were measured with
文摘Seeds of japonica rice (cv. Zhenuo 2) at twodifferent physiological states (dry seeds withwater content 13% and wet seeds soaked inthe water for 36 h) were irradiated by COlaser in four different power-densities. Theseeds irradiated by 200GY ofCo γ rays andno radiated seeds were used as the controls.Results showed that the biological effects
文摘Nutritious value of seed storage protein is low due to deficiency in essential amino acid contents. Cereals are mainly deficient in lysine and legumes in sulfur-containing amino acids (methionine and cysteine). So far, several sufur-rich seed protein genes have been isolated and the essential amino acid contents of seed proteins were increased in transgenic tobacco and Brassica napus. In this paper we report the isolation and sequencing of the 10kd prolamin gene from seeds. Poly(A) RNA were prepared from the immature endosperms of japonica rice, Sachiminori, 10 d after flowering. Complementary DNAs were synthesized according to Promega Instruction Manual. Two primers were synthesized and their sequences were Primer Ⅰ: CGTCTACACCATCTGGAATC, Primer Ⅱ: GTGTTTGCAGATAGTATGC. The amplified fragraents were inserted into the Sma I site of pGEM-7zf(+) and was used to transform E. coli JM101 after PCR reaction. DNA sequence were determined by Sanger’s Chain-termination method. Synthesis of cDNA. Using mRNAs as
基金supported by the Natural Science Foundation of China(60008001)the Natural Science Foundation of Zhejiang Province(300297).
文摘Incompletely closed glumes, germination on panicle and disease are three important factors causing poor seed quality of hybrid rice. To determine how many and which categories should be classified to meet the demand for seed in rice production, the effects of various degrees of incompletely closed glumes, germination on panicle and disease on germination percentage at the harvest and after storage for six months were studied by standard germination percentage test. Six categories of seeds with germ (germinated seeds), severe disease, incompletely closed glumes, spot disease, fine fissure and normal seeds were inspected and then treated separately. Images of the five hybrid rice seed (Jinyou 402, Shanyou 10, Zhongyou 27, Jiayou 99 and Ⅱ you 3207) were acquired with a self-developed machine vision system. Each image could be processed to get the feature values of seed region such as length, width, ratio of length to width, area, solidity and hue. Then all the images of normal seeds were calculated to draw the feature value ranges of each hybrid rice variety. Finally, an image information base that stores typical images and related feature values of each variety was established. This image information base can help us to identify the classification limit of characteristics, and provide the reference of the threshold selection. The management of large numbers of pictures and the addition of new varieties have been supported. The research laid a foundation for extracting image features of hybrid rice seed, which is a key approach to future quality inspection with machine vision.
基金Supported by National Key Research and Development Project(2018YFD0101000)
文摘In this study,two indica varieties with different dormancy characteristics [4 K58( II-32 B dormant),4 K59( II-32 B) ] and their F2 seeds( C178,C179) obtained through hybridization with sterile line( II-32 A) were used as materials. Different aged seeds( 0,3,6 and 9 d) of these four varieties were acquired by artificial accelerated aging method. Effects of artificial aging on malondialdehyde( MDA) content and catalase( CAT),ascorbate peroxidase( APX),peroxidase( POD) and superoxide dismutase( SOD) activity were investigated. The results showed that with the prolongation of aging time,MDA contents of these four rice varieties increased significantly,while the activity of antioxidant enzymes decreased dramatically. Besides,MDA contents and SOD,CAT and APX activity of the two inbred lines were significantly lower than those of the hybrid varieties. In addition,the activity of antioxidant enzymes in 4 K58 and C178 was significantly lower than that in 4 K59 and C179,respectively. This study indicated that artificial aging treatment significantly inhibited the activity of antioxidant system in seeds,improved membrane lipid peroxidation degree,and thus aggravated the deterioration of seeds. In addition,it also suggested that rice seeds with dormant property were more intolerant to storage.
文摘To better understand the effect and mechanism of cold tolerant seed-coating agents on the cold tolerance of rice seedlings, the physiological and biochemical effects of four cold tolerant seed-coating agents (HET, YKJ, YKZYJ, and the ABA seed coating agents) on two early indica rice varieties were studied under chilling stress. The results showed that the rice seedlings treated with cold tolerant seed-coating agents under chilling stress maintained dramatically higher root vigor, POD, CAT and SOD activities, and chlorophyll content, had lower MDA content and electrolyte leakage, and accumulated more soluble sugar and free proline, when compared with the control without the treatment, and finally showed lower plant injury rate. It was indicated that the cold tolerant seed coating agent improved the ability of rice seedlings in resisting to chilling stress. YKZYJ was ranked the first in terms of the efficiency in cold tolerance among the four cold tolerant seed-coating agents tested.
文摘We studied the influence of seed priming with beta-amino butyric acid(BABA) on the growth, physiological and biochemical parameters of seedlings with varied abiotic stress tolerance, which were raised and grown under unstressed and stressed(NaCl/PEG-6000) conditions. Under stressed conditions, the growth of rice seedlings was less when compared to control plants. After BABA priming, the seedling growth increased both under unstressed and stressed conditions as compared to the respective controls. BABA priming of rice seeds caused increase in the photosynthetic pigment content of the leaves, modified the chlorophyll a fluorescence related parameters and also enhanced the photosystem activities of seedlings when compared to their respective non-primed controls. BABA priming also caused increased mitochondrial activities of the rice seedlings. Moreover, BABA priming significantly reduced malondialdehyde content in the seedlings and also resulted in accumulation of proline especially in the NaCl tolerant variety Vyttila 6. BABA seed priming also enhanced the activity of nitrate reductase enzyme and activities of antioxidant enzymes like guaiacol peroxidase and superoxide dismutase. The presence of BABA was detected by high performance thin layer chromatography analysis in the rice seeds whereas in the seedlings it was not detected. Thus, it can be inferred that the seed priming effect of BABA mainly occurred within the seeds, which was further carried to the seedlings. It is concluded that BABA priming of seeds improved the drought and salinity stress tolerance of all the three rice varieties and it was significantly evident in the drought tolerant variety Vaisakh and NaCl tolerant variety Vyttila 6, when compared to the stress sensitive variety Neeraja.
基金Supported by the Open Fund of Hubei Key Laboratory of Economic Forest Germplasm Improvement and Resources Comprehensive Utilization,Huanggang Normal University(2013000503)
文摘Germination and hydroponic experiments are performed on rice seeds growing in soils treated with Cd stress,with rice seeds of the same variety that is not treated with Cd stress as a control,to study the effects of Cd stress on quality of rice seeds.The results have shown that:(1)Cd stress reduces the thousand grain weight of rice seeds,and higher Cd content means lower thousand grain weight;(2)The germination vigor and germination percentage of rice seeds under Cd stress as well as theirα-amylase activity andβ-amylase activity are all lower than those of the control.They decreases as the Cd stress increases;(3)For rice seeds under Cd stress,the height,fresh and dry weight of seedlings,as well as the chlorophyll content,photosynthetic rate and content of soluble protein of their leaves are all lower than those of the control.This indicates that Cd stress has certain effects on the germination and growth of the rice seeds.
基金Supported by Project of Hubei Agricultural Science and Technology Innovation Center(2007-620-003-03-05)Open Fund Project of Hubei Collaborative Innovation Center for Grain Industry(LXT-16-03)
文摘In the economic new normal,production of hybrid rice seed in foreign countries is the necessity for reducing farmland area occupied by seed production,for ensuring national grain security,realizing cost reducing and quality improving of hybrid rice seed,strengthening competitive power at international market,guiding seed industry of China to go out,building transnational seed groups with core competitive power,establishing close relationship with developing countries,promoting the construction of One Belt One Road strategy,serving overall situation of diplomacy,and setting up excellent international image. It is feasible to produce hybrid seed in foreign countries considering( i) high overall national strength of China,( ii) rapid and healthy growth of China's seed industry and increasingly mature hybrid rice seed production technologies,( iii) excellent climatic conditions of foreign host countries of seed production,and( iv) low land and labor price of foreign host countries of seed production. However,there are social and policy risks,technology and trade barrier risks,market,production,and other risks for production of hybrid rice seed in foreign countries. In view of these,it came up with recommendations,including allowing delivering parent seeds of hybrid rice to foreign countries,allowing delivering hybrid rice seed to China,solving the problem of " opening in protection,and protection in opening",and formulating a package of support policies.
基金Supported by Special Project of Scientific and Technological Achievement Conversion in Jiangsu Province(BA2011098)
文摘To study the production technology of rice seeds,with Lianjing 7 as test material,this paper explores the effects of the key rice seed production,processing and storage technologies( such as nitrogen fertilizer application and management,weeding mode in seed breeding field,temperature control of mechanical drying and water control on seed storage) on the quality of rice seeds. The results show that the optimal application proportion of tillering stage dressing and earing fertilizer is 8: 2,followed by 7 : 3; the best time of weeding is booting stage,with the highest purity; the effect of drying and germination rate is best when the temperature is controlled at 44℃ in mechanical drying process; the seed storage quality and storage costs can be guaranteed when the water content of rice seed is controlled at 18%.
文摘In this study, 151 households were randomly drawn from three randomly selected Kebele in probability proportional to size method. The demographic and socio-economic factors that determine the participation in improved varieties were household labor availability, education level of the household head,land holdings, distance to the nearest village market, proximity to the main market, and distance to access agricultural extension and access to the source of rice seeds. However, determinants of choice decision varied from cultivar to cultivar. The evidence of the study from the interdependence among the decision of adoption of improved rice varieties suggested that technology adoption will be accelerated by launching a progressively developing package and scheme of rice technology generation, and points to the importance of mobilising additional resources to augment households' efforts at popularization and promotion of improved rice cultivars.The findings from Linearized Almost Ideal Demand Systems(LA/AIDS) model showed that compelling evidence for small proportion changes in own prices and cross price of improved rice varieties led to greater than unitary proportionate changes in their purchases. The results generally showed that farmers were very sensitive to changes in improved rice seed prices and incomes. The major implication of the findings was that any intervention to improve farmers' seed purchases should take into account efforts to increase farmers' purchasing power of agricultural inputs like improved seeds and fertilizers.
基金supported by the National Key Technology R&D Program, China (Grant No. 2013BAD01B01)the National Natural Science Foundation of China Program (Grant Nos. 31371713 and 31401470)+1 种基金the Agricultural Science and Technology Innovation Program / Crop Germplasm Resources Preservation and Sharing Innovation Teamsupported by Central Laboratory of Biotechnology Research Institute, Chinese Academy of Agricultural Science
文摘The critical node(CN) is an important stage during seed aging, which is related to effective genebank conservation. Previous studies have demonstrated that proteins undergo carbonylated modification at the CN in rice, indicating oxidative damage. However, the levels of reactive carbonyl species(RCS) and the associated scavenging system at the CN are largely unknown. In this study, we optimized methods for the extraction and analysis of RCS from dry rice embryos. In order to acquire seeds at the CN, rice seeds were subjected to natural conditions for 7, 9, 11 and 13 months, and the seed germination rates were reduced to 90%, 82%, 71% and 57%, respectively. We chose the stage with seed germination rate of 82% as the CN according to the rice seed vigor loss curve. The levels of crotonaldehyde and 4-hydroxy-(E)-2-nonenal(HNE) were significantly increased at the CN. In addition, genes encoding carbonyl-scavenging enzyme, including Os ALDHs and Os AKRs, were significantly down-regulated at the CN, and reductions in the expression of Os ALDH2-2, Os ALDH2-5, Os ALDH3-4, Os ALDH7, Os AKR1 and Os AKR2 in particular could be responsible for RCS accumulation. Thus, the accumulations of crotonaldehyde and HNE and down-regulation of genes encoding carbonyl-scavenging enzyme might be related to an accelerating loss of seed viability at the CN.