Objective: This study aimed to report the case of a female patient with chronic myeloid leukemia affected by cryptococcal meningitis. Case report: ML, white, 48 years old, female sex, previously diagnosed with chronic...Objective: This study aimed to report the case of a female patient with chronic myeloid leukemia affected by cryptococcal meningitis. Case report: ML, white, 48 years old, female sex, previously diagnosed with chronic myeloid leukemia that has been refractive to the use of imatinib and who has recently begun using nilotinib, was admitted complaining of sudden and disabling migraine in the last 1 month associated with asthenia, adinamia, anorexia, disinterest for daily activities, dizziness, nausea, and vomiting. She evolved with ataxia, and started to stroll with help and showed decrease of muscular strength in her upper limbs. She also presented episodes of decrease of consciousness, with look fixation, no respond to sound stimulation, and short-term hearing loss. The cerebrospinal fluid showed presence of Cryptococcus sp. and, therefore, we began treatment with intravenous liposomal amphotericin B in the dose of 3 mg/kg/day, for 6 weeks. A new cerebrospinal fluid analysis, at the end of treatment, also showed rare structures that are compatible with Cryptococcus sp. As sequelae, she continued with hearing loss in her right ear and enhancement in her right auditory canal, seen in the magnetic resonance imaging. After stabilization and clinical improvement, she was discharged. After 3 weeks, she was hospitalized again with degeneration of the condition, and died due to intracranial hypertension secondary to cryptococcal infection. Final Considerations: This report reinforces the need of reflecting on fungi pathologies, especially in immunosuppressant patients, as well as the importance of early diagnosing and making a fast intervention, with the aims of providing quality of life and comfort to the patient and of minimizing neurological sequelae to the patient.展开更多
Objective: To describe the clinical, epidemiological and evolutionary aspects of cryptococcal meningitis. Methods: This was a retrospective descriptive study on all HIV-infected patients who had been hospitalized for ...Objective: To describe the clinical, epidemiological and evolutionary aspects of cryptococcal meningitis. Methods: This was a retrospective descriptive study on all HIV-infected patients who had been hospitalized for cryptococcal meningitis between 2006 and 2016 in the principal structures for the care of HIV infected person in Lomé. The diagnosis of meningitis was clinical and confirmed by the presence of cryptococci on Chinese ink or the detection of CSFsoluble antigens. All patients have made the CD4 rate assay and received an antifungal treatment based on fluconazole or Amphotericin B, followed later by antiretroviral triple therapy. Results: A total of 102 patients infected with cryptococcal meningitis (62 men for 40 women) were found. The sex ratio was 1.55. The median age was 34 years with extremes of 15 to 49 years. Clinically, headache was the symptomatic symptom in 100% of cases, prone to long runs and weight loss respectively in the proportions of 45% and 65%. The mean CD4 cell count was 65 ± 22 cells per mm3. The duration of hospital stay was short (less than 7 days) for the deceased. A total of 62 patients were able to receive treatment, 40 of them with fluconazole and 22 with Amphotericin B. The mortality was very high (65%), 25% were lost to follow-up, and 9.5% still in live 3 months after admission to the hospital. Conclusion: Cryptococcal meningitis has a very reserved prognosis. It is to be feared in cases of severe immunosuppression, hence the early detection of HIV for optimal management is important.展开更多
A 35-year-old man(body weight=63 kg)with AIDS complaining fever and headache after having commenced anti-retroviral therapy(ART)for a week was admitted to our hospital.Five lumbar punctures performed during38 days cou...A 35-year-old man(body weight=63 kg)with AIDS complaining fever and headache after having commenced anti-retroviral therapy(ART)for a week was admitted to our hospital.Five lumbar punctures performed during38 days could not confirm a cryptococcal meningitis(CM)based on staining or culture methods for cerebrospinal fluid(CSF).The disease quickly progressed with serious hearing/vision impairment and frequent onset of seizure and coma after being treated with corticosteroids for five days,and then CM was confirmed.Subsequent lumbar puncture showed elevated intracranial pressure as high as 870 mm H2O,even though treated with standard antifungal regimens for CM.His disease was finally controlled by a new triple therapy with amphotericin B(0.7mg?kg-1?day-1,intravenously),flucytosine(100 mg/kg perday,orally in four divided doses),and voriconazole(200mg every 12 hours)and ART containing lamivudine(300 mg/day),stavuding(30 mg,twice a day)and efavirenz(300 mg,orally every night).Although it is rare,negative CSF stain or culture for cryptococci in AIDS patients with CM can persist for a long time.Corticosteroids should be used cautiously when an effective anti-fungal therapy is not administered.Triple therapy with amphotericin B,flucytosine and voriconazole may be selectively applied in severe CM.Voriconazole can be co-administered with efavirenz with modified dosing.展开更多
Diffuse leptomeningeal glioneuronal tumor(DLGNT)in adolescent female is rare and easy to be misdiagnosed due to its nonspecificity.This article described the characteristics of an adolescent female DLGNT patient with ...Diffuse leptomeningeal glioneuronal tumor(DLGNT)in adolescent female is rare and easy to be misdiagnosed due to its nonspecificity.This article described the characteristics of an adolescent female DLGNT patient with no history of tumor whose first symptoms are headache and vision loss,and analyzed the causes why DLGNT is easy to be misdiagnosed as cryptococcal meningitis.Treatment remedies:the adolescent female presented with progressive exacerbations of headache,vomiting and vision loss after general treatment.Dynamic monitoring of routine biochemical changes in cerebrospinal fluid(CSF)found abnormal high CSF pressure and protein,repeated examination of antibodies and acid-fast bacilli were negative,and high-throughput pathogen gene examination excluded viral meningitis,tuberculous meningitis and other diseases.To save the optic nerve,the Ommaya capsule was implanted to reduce the intracranial pressure.After diagnostic antifungal treatment,the patient’s condition did not improve.To identify the etiology,extensive meningeal enhancement was eventually detected by enhanced magnetic resonance imaging(MRI),and highly atypical tumor cells were identified by repeated examination of fresh CSF cytology.Post treatment evaluating:for DLGNT,consult oncology.Meningeal biopsy and PET-CT(positron emission tomographycomputed tomography)examination were recommended,and intrathecal chemotherapy and whole-brain radiotherapy were performed according to the examination results.But the patient’s family refused to have a meningeal biopsy and asked to be released from the hospital.Conclusions:the adolescent female without a history of tumor can not rule out the disease,and cryptococcal meningitis also has meningeal enhancement.The gold standard for the diagnosis of DLGNT is to find cancer cells.There is no effective cure for DLGNT,the timely placement of Ommaya sac can significantly improve the quality of the patient’s life,and the active adoption of targeted therapy is expected to extend the patient’s survival.展开更多
BACKGROUND: At present, fluconazole and intrathecal injection of amphotericin B has been widely used to treat cryptococcal meningitis. However, the application of amphotericin B can shorten course and has good effects...BACKGROUND: At present, fluconazole and intrathecal injection of amphotericin B has been widely used to treat cryptococcal meningitis. However, the application of amphotericin B can shorten course and has good effects on the treatment of cryptococcal meningitis. OBJECTIVE: To observe the effects and poor response of the intrathecal injection of amphotericin B on the treatment of cryptococcal meningitis. DESIGN: Retrospective-case analysis. SETTING: Department of Neurology, Beijing Hospital of Ministry of Public Health. PARTICIPANTS: Eight patients with cryptococcal meningitis were selected from Department of Neurology, Beijing Hospital of Ministry of Public Health from January 1995 to January 2006. Among them, there were 3 males and 5 females aged from 17 to 41 years and the course ranged from 21 days to 3 months. Patients who had symptoms of febrile and headache, positive meninges excitation, positive latex agglutination of cryptococcus of cerebrospinal fluid and positive ink smear were selected in this study. All patients provided informed consent. METHODS: Eight patients were treated with the fluconazole and intrathecal injection of amphotericin B. ① Intracranial hypertension of patients was controlled with flowing cerebrospinal fluid by repeatedly piercing waist; meanwhile, patients were taken the intrathecal injection of amphotericin B combining with flucytosine or fluconazole treatment. The dosage of amphotericin B was 1-5 mg/d at the beginning of administration, and then, the samples were added with 2 mg dexasine and 500 mL 5% glucose solution. The dosage was increased 5.0 mg per day till 50 mg per day, and the total dosage was 3.0-4.0 g. In addition, 2 mg dexasine was mixed with 4.0-5.0 mL cerebrospinal fluid, and then the solution was gradually injected into sheath for once a week. Fluconazole was dripped into vein with the volume of 400 mg per day, and then, 14 days later, fluconazole was orally taken by patients. ② Other therapies, such as decreasing intracranial hypertension, were used at the same time of administration. When cryptococcus of cerebrospinal fluid was negative, patients received the secondary therapy at anaphase. The drug withdrawal was not performed untill ink smear of cerebrospinal fluid was negative for 3 successive cultures. ③ Evaluative criteria: Evaluative criteria were classified into 4 styles: Cure: Clinical symptoms and physical signs disappeared and ink smear of cerebrospinal fluid was negative for 3 successful cultures; Improvement: Clinical symptoms and physical signs were improved remarkably, amount of cerebrospinal fluid was decreased, and ink smear was not negative; inefficiency and death. MAIN OUTCOME MEASURE: Clinical effects and poor responses of intrathecal injection of amphotericin B and fluconazole treatment. RESULTS: Among 8 patients with cryptococcal meningitis, one died due to intracranial hypertension combining with cerebral hernia, and others were returned visit at 1 year after drug withdrawal. ① Clinical effects: Among 8 patients with cryptococcal meningitis, 4 were cured, 3 were improved, and one died. There was no relapse case. ② Results of mycological examination: After first intrathecal injection of 4 improved patients, the amount of cryptococcus of cerebrospinal fluid was decreased 20%-30%; in addition, after intrathecal injection for twice or three times, the amount was decreased 33%-50%. ③ Improvement of intracranial hypertension: Seven patients had the intracranial hypertension. After intrathecal injection for twice or three times, pressure of cerebrospinal fluid was decreased below 2 451.75 Pa, and the clinical symptoms were relieved remarkably. ④ Poor responses: After intrathecal injection, patients had headache, nausea, emesis and pain of lower limb. Especially, 2 cases had transient paraplegia of both lower limbs, one had retention of urine, and two had conscious disturbance. CONCLUSION: Controlling intracranial hypertension with repeatedly piercing waist and intrathecal injection of amphotericin B combining with fluconazole treatment are well therapeutic effects on the fluconazole treatment of cryptococcal meningitis. Healing rate is 50%; however, there are a lot of poor responses at various degrees.展开更多
Rationale:Cryptococcal infections commonly occur in immunosuppressed patients and are uncommon in immunocompetent persons.Patient concerns:A 32 year old lady,active smoker presented with right chest pain,dry cough and...Rationale:Cryptococcal infections commonly occur in immunosuppressed patients and are uncommon in immunocompetent persons.Patient concerns:A 32 year old lady,active smoker presented with right chest pain,dry cough and loss of weight.Initial chest radiograph showed a lobulated lung mass in the right lower lobe.She developed headache and right cranial nerve palsy during admission.Various investigations were done including lumbar puncture,brain and chest imaging.Diagnosis:Cryptococcal meningitis with pulmonary cryptococcoma.Interventions:She received five months of effective antifungal treatment;however,the patient did not respond well.Subsequently,removal of pulmonary cryptococcoma was done.Outcomes:Her condition improved and she no longer had any headache.Lessons:Disseminated cryptococcosis is rare in immunocompetent patient.Our case highlights the importance of high index of suspicion and we postulate that lobectomy helped in reducing the cryptococcal burden in her body,thus facilitating better response to antifungal therapy.展开更多
BACKGROUND Aseptic meningitis is defined as meningeal inflammation caused by various etio-logies with negative cerebrospinal fluid(CSF)bacterial culture.The most common etiologies are viruses[enteroviruses,arboviruses...BACKGROUND Aseptic meningitis is defined as meningeal inflammation caused by various etio-logies with negative cerebrospinal fluid(CSF)bacterial culture.The most common etiologies are viruses[enteroviruses,arboviruses,and herpes simplex virus type 2(HSV-2)].Aseptic meningitis can have various presentations,including sensori-neural deafness.While sensorineural deafness from mumps meningoencephalitis has been reported,cases of HSV-2-induced hearing loss are rare.Herein,we re-port a case of HSV-2-induced meningitis that presented with sudden deafness.CASE SUMMARY A 68-year-old man experienced a profound sudden onset of left-sided hearing loss for one day.Pure-tone audiograms demonstrated sudden left-sided sensorineural hearing loss(thresholds 80-90 dB).After treatment with high-dose steroids for 1 week,he experienced an acute consciousness change with left hemiparesis.The laboratory data showed no significant abnormalities.Brain computed tomography without contrast and magnetic resonance imaging revealed no intracranial hemo-rrhage or obvious brain lesion.The CSF analysis and the Multiplex PCR panels showed HSV-2 positivity.Hence,under the diagnosis of herpes meningoenceph-alitis,acyclovir was prescribed and his symptoms gradually resolved.CONCLUSION This case report further demonstrates that a viral infection could be a cause of sudden sensorineural hearing loss.展开更多
BACKGROUND Meningitis remains a significant source of mortality and morbidity,with an incidence of 1 per 100000 persons in the United States.Guidelines recommend obtaining blood cultures and cerebrospinal fluid(CSF)st...BACKGROUND Meningitis remains a significant source of mortality and morbidity,with an incidence of 1 per 100000 persons in the United States.Guidelines recommend obtaining blood cultures and cerebrospinal fluid(CSF)studies in patients presenting with acute meningitis syndrome,and beginning treatment with broad spectrum antibiotics based on the age and certain predisposing conditions.In some patients however,the diagnostic lumbar puncture(LP)is not performed due to a multitude of reasons,ranging from increased intracranial pressure to failed attempt.In such situations,appropriate therapy is initiated empirically and often continued without establishment of a definitive diagnosis.AIM To determine whether a diagnostic LP in acute meningitis syndrome was associated with a better outcome and less duration of antibiotic therapy,along with potential causes for deferral of procedure.METHODS A retrospective study was conducted amongst the patients presenting to a 360 bedded community hospital in central Massachusetts with a diagnosis of acute meningitis syndrome between January 2010-September 2022.The electronic health records were accessed to collect necessary demographic and clinical data,including etiology of meningitis,lumbar puncture results,reason for procedure deferral,duration of antibiotic therapy and clinical outcome.The patients were subsequently divided into two groups based on whether they received a LP or not,and data was analyzed.RESULTS A total of 169 patients admitted with acute meningitis syndrome between September 2010-2022 were included in the study.The mean age of the participants was 54.3 years(SD+/-19.2 years).LP was performed for 130(76.9%)participants,out of which,28(21.5%)showed some growth in CSF culture.The most commonly identified organism was streptococcus pneumoniae.Amongst the 39 patients in whom LP was deferred,the major reasons recorded were:Body habitus(n=6,15.4%),and unsuccessful attempt(n=4,10.3%).While 93(71.5%)patients with LP received antibiotic therapy,only 19(48.7%)patients without LP received the antibiotics,with the principal reason being spontaneous improvement in sensorium without any diagnosed source of infection.The mean duration of antibiotic use was 12.3 days(SD+/-5.6)in the LP group and 11.5 days(SD+/-7.0)in the non-LP group(P=0.56;statistically not significant).We observed higher long term sequalae in the non-LP group(n=6,15.4%)compared to the LP group(n=9,6.9%).Similarly,the death rate was higher in the non-LP group(n=7,18.0%)compared to the LP group(n=9,6.9%).CONCLUSION LP remains the cornerstone for diagnosing meningitis,but often CSF results are unavailable,leading to empiric treatment.Our study identified that body habitus and unsuccessful attempts were the most common reasons for LP not being performed,leading to empiric antibiotic coverage.There was no difference between the duration of antibiotics received by the two groups,but a lower proportion of patients without LP received antibiotics,attributed to a spontaneous improvement in sensorium.However,the residual neurological sequelae and death rates were higher in patients without LP,signifying a potential under-treatment.A LP remains crucial to diagnose meningitis,and a lack of CSF analysis predisposes to under-treatment,leading to higher neurological sequelae and increased chances of death.展开更多
Objective:To evaluate laboratory findings that predict bacterial meningitis in emergency service and their diagnostic effectiveness.Methods:This retrospective cohort study analyzed data from patients presenting with m...Objective:To evaluate laboratory findings that predict bacterial meningitis in emergency service and their diagnostic effectiveness.Methods:This retrospective cohort study analyzed data from patients presenting with meningitis symptoms at a referral hospital in Mersin,Turkey,between January 2019 and January 2022.Clinical findings and laboratory results,including leukocyte count,C-reactive protein(CRP),and procalcitonin levels in blood,were examined.Logistic regression,Chi square test,and receiver operating characteristics(ROC)curve analyses assessed the predictive value of these parameters.Results:A total of 199 participants were included in the study;99 patients were diagnosed with meningitis after lumbar puncture and 100 served as controls.Patients with meningitis exhibited significantly higher leukocyte counts(median:11890×10^(3)/μL vs.7905×10^(3)/μL,P<0.001)and CRP levels(median:6.00 mg/dL vs.0.95 mg/dL,P<0.001)compared to controls.Procalcitonin levels were significantly elevated in meningitis patients(median:0.21 ng/mL vs.0.10 ng/mL,P<0.001).Logistic regression identified albumin(OR=0.16,95%CI=0.06-0.40),and CRP(OR=1.18,95%CI=1.08-1.28)as independent predictors of meningitis.ROC analysis for CRP demonstrated a sensitivity of 80.6%and specificity of 70.0%at a cut-off value of 2.23 mg/dL(AUC=0.792).Conclusions:Elevated albumin levels and CRP contents in the blood were significant predictors of meningitis in emergency service.Early identification of predictive markers may aid in timely lumbar puncture and management of atypical cases.展开更多
Objective Pseudomonas aeruginosa(P.aeruginosa)is a prevalent pathogenic bacterium involved in meningitis;however,the virulence factors contributing to this disease remain poorly understood.Methods The virulence of the...Objective Pseudomonas aeruginosa(P.aeruginosa)is a prevalent pathogenic bacterium involved in meningitis;however,the virulence factors contributing to this disease remain poorly understood.Methods The virulence of the P.aeruginosa A584,isolated from meningitis samples,was evaluated by constructing in vitro blood-brain barrier and in vivo systemic infection models.qPCR,whole-genome sequencing,and drug efflux assays of A584 were performed to analyze the virulence factors.Results Genomic sequencing showed that A584 formed a phylogenetic cluster with the reference strains NY7610,DDRC3,Pa58,and Pa124.Its genome includes abundant virulence factors,such as hemolysin,the Type IV secretion system,and pyoverdine.A584 is a multidrug-resistant strain,and its wide-spectrum resistance is associated with enhanced drug efflux.Moreover,this strain caused significantly more severe damage to the blood-brain barrier than the standard strain,PAO1.qPCR assays further revealed the downregulation of the blood-brain barrier-associated proteins Claudin-5 and Occludin by A584.During systemic infection,A584 exhibited a higher capacity of brain colonization than PAO1(37.1×10^(6) CFU/g brain versus 2.5×10^(6) CFU/g brain),leading to higher levels of the proinflammatory factors IL-1βand TNF-α.Conclusion This study sheds light on the virulence factors of P.aeruginosa involved in meningitis.展开更多
Streptococcus suis serotype 2(SS2)is an emerging zoonotic pathogen that causes meningitis in humans and pigs.This pathogen generates substantial economic losses in the swine industry while posing a significant threat ...Streptococcus suis serotype 2(SS2)is an emerging zoonotic pathogen that causes meningitis in humans and pigs.This pathogen generates substantial economic losses in the swine industry while posing a significant threat to public health security.The mechanisms through which SS2 penetrates the brain and induces meningitis remain incompletely understood.This study examines the role and mechanism of SS2 collagenase-like protease(Clp)in facilitating bacterial passage across the blood-brain barrier(BBB).The research demonstrates that SS2 Clp enhanced virulence and tissue colonization while promoting BBB degradation in mice.The Δclp mutant exhibited reduced ability to traverse human brain microvascular endothelial(hCMEC/D3)cell monolayers compared to wild-type SS2,while the addition of recombinant protein rClp increased permeability.Furthermore,rClp significantly enhanced SS2 adhesion to hCMEC/D3,suppressed the expression of intercellular tight junction proteins ZO-1,Occludin,and Claudin-5 independent of its enzyme activity,and triggered hCMEC/D3 apoptosis through cell receptor ligand apoptosis and mitochondrial apoptosis pathways,partially dependent on its enzyme activity,leading to BBB disruption and enhanced permeability.Additionally,Clp enhanced the infiltration of macrophages(F4/80+),monocytes(F4/80-Ly6C+),and neutrophils(Ly6G+)into the brain following SS2 infection.These findings establish that SS2 Clp is essential for bacterial passage across the BBB,offering a theoretical foundation for improved prevention and treatment strategies for SS2-induced meningitis.展开更多
Background:Invasive meningococcal disease is a potentially life-threatening infection caused by Neisseria meningitidis.Vaccination is highly effective in preventing meningitis and reducing its associated complications...Background:Invasive meningococcal disease is a potentially life-threatening infection caused by Neisseria meningitidis.Vaccination is highly effective in preventing meningitis and reducing its associated complications.This study aims to assess the United Arab Emirates(UAE)parents meningitis knowledge and explore vaccination attitudes and practices.Methodology:An observational cross-sectional study was conducted between March and May 2024 across the UAE using convenience sampling through social media,electronic mail,and word of mouth.A 58-item questionnaire collected information regarding demographics,meningitis knowledge,attitudes and practices,and meningococcal vaccination knowledge and practices.Results:Of 443 parents included,more than a third had no knowledge about meningitis.Symptoms and severity were well-recognized overall,but clear gaps were evident regarding complications and meningococcal vaccines.Only 10.38%(46/443)identified themselves as knowledgeable/very knowledgeable regarding meningococcal vaccines.A healthcare provider recommendation was the strongest factor encouraging parents to vaccinate their child.Most vaccine hesitancy was seen regarding side effects.Views and practices regarding the two vaccines aligned closely,with more than four-fifths of participants needing more information and the major reasons for not vaccinating a child being a lack of information or lack of recommendation.Social media and governmental websites were the most common sources for learning more about meningitis,with doctors ranking third.In fact,trust in doctors varied with less than half having moderate or strong trust in their main paediatrician.Multivariate logistic regression revealed that coronavirus disease 2019 vaccination status[adjusted odds ratio(AOR):0.365,95%confidence interval(CI):0.172 to 0.774,P=0.013]and female gender(AOR:2.741,95%CI:1.184 to 6.347,P=0.019)were significant predictors of vaccine hesitancy.Conclusion:Meningococcal vaccine hesitancy is a significant concern,primarily driven by fears of side effects and lack of knowledge and physician recommendation.However,vaccine attitudes were overall positive and highly dependent on physician involvement.There is a need for targeted educational initiatives enhancing meningitis disease awareness and vaccine uptake.展开更多
The presence of the blood–brain barrier limits the drug concentration in the brain,while low concentrations of antibiotics make it difficult to kill infecting bacteria and tends to induce drug resistance,making the c...The presence of the blood–brain barrier limits the drug concentration in the brain,while low concentrations of antibiotics make it difficult to kill infecting bacteria and tends to induce drug resistance,making the clinical treatment of bacterial meningitis challenging.Herein,a nose-to-brain delivery strategy of small-sized nanozyme has been fabricated for combating bacterial meningitis,to overcome the low drug concentration and drug resistance.This strategy was achieved by a proteinsupported Au nanozyme(ANZ).With a particle size of less than 10 nm,it possesses both glucose oxidase-like and peroxidase-like activities and can generate large amounts of reactive oxygen species through a cascade effect without the addition of external H_(2)O_(2).Benefiting from the cascade catalytic amplification effect generated by its dual enzymelike activities,ANZ shows significant broad-spectrum antibacterial activity without inducing bacterial resistance in vitro.Notably,small-sized ANZ exhibits higher brain entry efficiency and greater accumulation after intranasal administration compared to oral or intravenous administration.In a mouse model of bacterial meningitis,the mice treated with ANZ had lower bacterial loads in the brain and higher survival and clinical behavior scores compared to the classical antibiotic ceftriaxone.Additionally,the meningitis mice exhibited undamaged cognitive and behavioral abilities,indicating the excellent biocompatibility of ANZ.The above results demonstrate that nose-to-brain delivery of ANZ exhibits high intracerebral accumulation,strong antibacterial efficacy and does not lead to bacterial resistance.It holds broad prospects for the treatment of bacterial meningitis.展开更多
BACKGROUND The World Health Organization(WHO)recommends lumbar puncture(LP)procedures to assess the diagnosis of cryptococcal meningitis(CM)among patients with advanced human immunodeficiency virus(HIV)disease(AHD)wit...BACKGROUND The World Health Organization(WHO)recommends lumbar puncture(LP)procedures to assess the diagnosis of cryptococcal meningitis(CM)among patients with advanced human immunodeficiency virus(HIV)disease(AHD)with positive serum cryptococcal antigen(CrAg)and do not have evidence of CM.AIM To estimate pooled prevalence of uptake of LP,CM and mortality among patients with AHD.METHODS PubMed,Cochrane Library and EMBASE were searched for articles published between January 2011 and December 2024.LP uptake was defined as percentage of people who underwent LP procedures among those with AHD(CD4≤200 cells/mm3 or WHO stage III/IV)and positive serum CrAg.Using random effects models,we computed the pooled estimate of LP uptake,CM and mortality and 95%CI.Stratified analyses were used to compare uptake of LP between studies that involved multiple vs single sites,and mortality analyses between patients with positive and negative serum CrAg were performed.Sensitivity analysis on LP uptake was done by excluding prospective cohort studies that reported 100%uptake.RESULTS A total of 32 studies with 46890 people with AHD screened for serum CrAg and 2730(5.8%)had positive serum CrAg.Overall,pooled prevalence of LP uptake was 67.7%(95%CI:54.0-81.5).The overall pooled prevalence of CM was 54.3%(95%CI:39.7-69.0),and mortality was 6.2%(95%CI:4.5-8.0).There is disparities in the pooled prevalence of LP uptake with studies involving multiple sites having lower prevalence compared to those that involved single sites(54.8%vs 84.7%,P=0.004).By excluding prospective cohort studies that reported 100%uptake,the overall LP uptake was 54.5%(95%CI:38.8-70.1).The pooled prevalence of CM was significantly lower among studies that involved multiple sites compared to those that involved single sites(6.8%vs 8.1%,P≤0.001).Mortality was significantly twice as high among patients who had positive serum CrAg compared to those who had negative serum CrAg[risk ratio=2.0(95%CI:1.6-2.5),P≤0.001].CONCLUSION Nearly three to five in 10 people with AHD with positive serum CrAg did not have LP procedures done,indicating significant gaps in identifying patients with CM.Establishing a confirmed diagnosis of CM is critical to avoid exposing patients to subtherapeutic levels of antifungals preemptively.Capacity to perform LP and patient refusals are among the reasons for not performing the procedure.Capacity building in training health care providers to perform LP procedures and professional counselling to obtain patient consent are critical for appropriate treatment to reduce mortality associated with CM infection.展开更多
Tuberculous meningitis(TBM),which accounts for 1%-5%of global tuberculosis cases,is a severe neurological infection with a mortality rate of 30%-50%.Its high fatality and disability rates disproportionately affect low...Tuberculous meningitis(TBM),which accounts for 1%-5%of global tuberculosis cases,is a severe neurological infection with a mortality rate of 30%-50%.Its high fatality and disability rates disproportionately affect low-and middle-income regions(e.g.,sub-Saharan Africa and Southeast Asia),threatening the lives of patients and imposing significant psychosocial burdens.Recent studies have highlighted the crucial role of psychosocial factors,including socioeconomic status,disease severity,and social support systems in recovery.However,research gaps persist in developing TBM-specific psychosocial interventions.This narrative review summarizes and organizes the key findings of observational studies,cohort studies,and intervention trials published between 2015 and 2024.Databases including PubMed,Scopus,and Web of Science were searched for terms related to TBM,psychosocial risk factors and mental health interventions.Studies were screened for relevance and quality,focusing on those that examined the psychological and social determinants of mental health outcomes in patients with TBM.展开更多
Background Amphotericin B （0.7 mg/kg） with flucytosine is the standard treatment for cryptococcal meningitis.However,the long treatment course can induce adverse reactions in patients; therefore,reducing the dose ma...Background Amphotericin B （0.7 mg/kg） with flucytosine is the standard treatment for cryptococcal meningitis.However,the long treatment course can induce adverse reactions in patients; therefore,reducing the dose may decrease such reactions.We performed a retrospective analysis of treatment effects and adverse reactions when amphotericin B （0.4 mg/kg or 0.7 mg/kg per day） and flucytosine were used together to treat HIV-negative patients with cryptococcal meningitis.Methods Retrospective analysis was conducted on inpatients at the First Affiliated Hospital,College of Medicine,Zhejiang University （January 2005 to December 2009）.Low- or high-dose amphotericin B （0.4 or 0.7 mg/kg per day,respectively） plus flucytosine was used.The negative conversion rate of Cryptococcus in the cerebrospinal fluid （CSF）,patient mortality,and the incidence of side effects for the two groups （low- vs.high-dose） were compared immediately after treatment and 2 and 10 weeks later.Data were analyzed by the Student＇s t test,chi-square tests using SPSS 12.0 statistical soitware.Results Two weeks post-treatment,Cryptococcus negative CSF rates were 78% （18/23） in the low-dose group and 87% （13/15） in the high-dose group （P=0.28）.Ten weeks post-treatment,both groups were negative.The mortality rate was 8% （2/25） in the low-dose group and 17% （3/18） in the high-dose group （P=-0.25）.There was a statistically significant difference in the incidence of adverse events between the groups,48% （12/25） and 78% （14/18） in the low- and high-dose groups,respectively （P=0.04）.Adverse events that required a change in treatment program in the low-dose group were 12% （3/25） compared to 39% （7/18） in the high-dose group （P=-0.04）.Conclusion Low-dose treatment regimens were better tolerated展开更多
Cryptococcus neoformans （C. neoformans） is the most common cause of fungal meningitis worldwide.1 Cryptococcal meningitis is an opportunistic infection commonly found in immunocompromised hosts, especially HIV-infe...Cryptococcus neoformans （C. neoformans） is the most common cause of fungal meningitis worldwide.1 Cryptococcal meningitis is an opportunistic infection commonly found in immunocompromised hosts, especially HIV-infected adults. It also occurs in apparently immunocompetent individuals. Rarely has it been reported in children, and it is almost nonexistent in infants. Voriconazole is a member of a second generation of antifungal triazoles with broad spectrum antifungal activity, oral and parenteral bioavailability and a favorable safety profile in adults.3 This patient shows improved in vitro activity against C. neoformans when compared to fluconazole and it has been used successfully in about half the patients with refractory cryptococcosis.4 However, the efficacy and safety of voriconazole as a antifungal agent in children with cryptococcal meningitis have not been well assessed, This report described cryptococcal meningitis in a 13-day-old premature neonate who recovered without overt toxicity after voriconazole was added to an antifungal regimen that included amphotericin B and flucytosine. We focused on the response of this child with cryptococcal meningitis to voriconazole.展开更多
Objective To compare the curative effects of three different antifungal regimens in the treatment of cryptococcal meningitis Methods Twenty two patients were divided into 3 groups: Group Ⅰ was given intravenous a...Objective To compare the curative effects of three different antifungal regimens in the treatment of cryptococcal meningitis Methods Twenty two patients were divided into 3 groups: Group Ⅰ was given intravenous amphotericin B alone or combination with flucytosine therapy Group Ⅱ received intravenous fluconazole alone or combination with flucytosine The treatment of Group Ⅲ was divided into two steps, where the patients received intrathecal amphotericin B plus intravenous amphotericin B with or without intravenous fluconazole until the mycological culture of cerebrospinal fluid (CSF) turned negative, followed by oral fluconazole or itraconazole as maintenance therapy until direct microscopic examination of CSF showed negative once a week for three consecutive weeks Results Of the twenty two patients, 17 (77 3%) were cured, 2 (9 1%) improved, 3 (13 6%) died, and one (4 5%) relapsed Of the 8 patients in Group Ⅰ, 5 were cured, 2 improved, one died and one relapsed; Of the 4 patients in Group Ⅱ, 2 were cured, and 2 died; All the 10 patients in Group Ⅲ were cured without any recurrence Conclusion The two step therapeutic regimen may be suited to the treatment of cryptococcal meningitis展开更多
Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as micr...Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.展开更多
In the non-human immunodeficiency virus infected population,cryptococcosis occurs primarily in people who are functionally immunosuppressed,including patients who have undergone solid organ transplantation requiring i...In the non-human immunodeficiency virus infected population,cryptococcosis occurs primarily in people who are functionally immunosuppressed,including patients who have undergone solid organ transplantation requiring immunosuppressive medications,are on corticosteroids,or have renal failure or cirrhosis.Cryptococcal meningitis poses a particular challenge in the setting of cirrhosis because its clinical presentation can mimic hepatic encephalopathy.Here,we describe two patients with decompensated cirrhosis,both with a known history of hepatic encephalopathy who had lumbar punctures and were found to have cryptococcal meningitis.The first patient had a subacute fluctuating change in mental status,while the second patient had progressive subacute headaches,gait disturbance,and hearing loss.Both patients were treated with amphotericin B and flucytosine induction,but only the second survived to maintenance therapy.These cases demonstrate the importance of having a high index of suspicion for cryptococcal meningitis in cirrhosis and having a low threshold for performing a lumbar puncture when altered mental status or other neurologic complaints are not fully explained by hepatic encephalopathy.We also provide a brief review of the pathobiology of cryptococcal infection in cirrhosis and highlight the challenges in therapy.展开更多
文摘Objective: This study aimed to report the case of a female patient with chronic myeloid leukemia affected by cryptococcal meningitis. Case report: ML, white, 48 years old, female sex, previously diagnosed with chronic myeloid leukemia that has been refractive to the use of imatinib and who has recently begun using nilotinib, was admitted complaining of sudden and disabling migraine in the last 1 month associated with asthenia, adinamia, anorexia, disinterest for daily activities, dizziness, nausea, and vomiting. She evolved with ataxia, and started to stroll with help and showed decrease of muscular strength in her upper limbs. She also presented episodes of decrease of consciousness, with look fixation, no respond to sound stimulation, and short-term hearing loss. The cerebrospinal fluid showed presence of Cryptococcus sp. and, therefore, we began treatment with intravenous liposomal amphotericin B in the dose of 3 mg/kg/day, for 6 weeks. A new cerebrospinal fluid analysis, at the end of treatment, also showed rare structures that are compatible with Cryptococcus sp. As sequelae, she continued with hearing loss in her right ear and enhancement in her right auditory canal, seen in the magnetic resonance imaging. After stabilization and clinical improvement, she was discharged. After 3 weeks, she was hospitalized again with degeneration of the condition, and died due to intracranial hypertension secondary to cryptococcal infection. Final Considerations: This report reinforces the need of reflecting on fungi pathologies, especially in immunosuppressant patients, as well as the importance of early diagnosing and making a fast intervention, with the aims of providing quality of life and comfort to the patient and of minimizing neurological sequelae to the patient.
文摘Objective: To describe the clinical, epidemiological and evolutionary aspects of cryptococcal meningitis. Methods: This was a retrospective descriptive study on all HIV-infected patients who had been hospitalized for cryptococcal meningitis between 2006 and 2016 in the principal structures for the care of HIV infected person in Lomé. The diagnosis of meningitis was clinical and confirmed by the presence of cryptococci on Chinese ink or the detection of CSFsoluble antigens. All patients have made the CD4 rate assay and received an antifungal treatment based on fluconazole or Amphotericin B, followed later by antiretroviral triple therapy. Results: A total of 102 patients infected with cryptococcal meningitis (62 men for 40 women) were found. The sex ratio was 1.55. The median age was 34 years with extremes of 15 to 49 years. Clinically, headache was the symptomatic symptom in 100% of cases, prone to long runs and weight loss respectively in the proportions of 45% and 65%. The mean CD4 cell count was 65 ± 22 cells per mm3. The duration of hospital stay was short (less than 7 days) for the deceased. A total of 62 patients were able to receive treatment, 40 of them with fluconazole and 22 with Amphotericin B. The mortality was very high (65%), 25% were lost to follow-up, and 9.5% still in live 3 months after admission to the hospital. Conclusion: Cryptococcal meningitis has a very reserved prognosis. It is to be feared in cases of severe immunosuppression, hence the early detection of HIV for optimal management is important.
文摘A 35-year-old man(body weight=63 kg)with AIDS complaining fever and headache after having commenced anti-retroviral therapy(ART)for a week was admitted to our hospital.Five lumbar punctures performed during38 days could not confirm a cryptococcal meningitis(CM)based on staining or culture methods for cerebrospinal fluid(CSF).The disease quickly progressed with serious hearing/vision impairment and frequent onset of seizure and coma after being treated with corticosteroids for five days,and then CM was confirmed.Subsequent lumbar puncture showed elevated intracranial pressure as high as 870 mm H2O,even though treated with standard antifungal regimens for CM.His disease was finally controlled by a new triple therapy with amphotericin B(0.7mg?kg-1?day-1,intravenously),flucytosine(100 mg/kg perday,orally in four divided doses),and voriconazole(200mg every 12 hours)and ART containing lamivudine(300 mg/day),stavuding(30 mg,twice a day)and efavirenz(300 mg,orally every night).Although it is rare,negative CSF stain or culture for cryptococci in AIDS patients with CM can persist for a long time.Corticosteroids should be used cautiously when an effective anti-fungal therapy is not administered.Triple therapy with amphotericin B,flucytosine and voriconazole may be selectively applied in severe CM.Voriconazole can be co-administered with efavirenz with modified dosing.
文摘Diffuse leptomeningeal glioneuronal tumor(DLGNT)in adolescent female is rare and easy to be misdiagnosed due to its nonspecificity.This article described the characteristics of an adolescent female DLGNT patient with no history of tumor whose first symptoms are headache and vision loss,and analyzed the causes why DLGNT is easy to be misdiagnosed as cryptococcal meningitis.Treatment remedies:the adolescent female presented with progressive exacerbations of headache,vomiting and vision loss after general treatment.Dynamic monitoring of routine biochemical changes in cerebrospinal fluid(CSF)found abnormal high CSF pressure and protein,repeated examination of antibodies and acid-fast bacilli were negative,and high-throughput pathogen gene examination excluded viral meningitis,tuberculous meningitis and other diseases.To save the optic nerve,the Ommaya capsule was implanted to reduce the intracranial pressure.After diagnostic antifungal treatment,the patient’s condition did not improve.To identify the etiology,extensive meningeal enhancement was eventually detected by enhanced magnetic resonance imaging(MRI),and highly atypical tumor cells were identified by repeated examination of fresh CSF cytology.Post treatment evaluating:for DLGNT,consult oncology.Meningeal biopsy and PET-CT(positron emission tomographycomputed tomography)examination were recommended,and intrathecal chemotherapy and whole-brain radiotherapy were performed according to the examination results.But the patient’s family refused to have a meningeal biopsy and asked to be released from the hospital.Conclusions:the adolescent female without a history of tumor can not rule out the disease,and cryptococcal meningitis also has meningeal enhancement.The gold standard for the diagnosis of DLGNT is to find cancer cells.There is no effective cure for DLGNT,the timely placement of Ommaya sac can significantly improve the quality of the patient’s life,and the active adoption of targeted therapy is expected to extend the patient’s survival.
文摘BACKGROUND: At present, fluconazole and intrathecal injection of amphotericin B has been widely used to treat cryptococcal meningitis. However, the application of amphotericin B can shorten course and has good effects on the treatment of cryptococcal meningitis. OBJECTIVE: To observe the effects and poor response of the intrathecal injection of amphotericin B on the treatment of cryptococcal meningitis. DESIGN: Retrospective-case analysis. SETTING: Department of Neurology, Beijing Hospital of Ministry of Public Health. PARTICIPANTS: Eight patients with cryptococcal meningitis were selected from Department of Neurology, Beijing Hospital of Ministry of Public Health from January 1995 to January 2006. Among them, there were 3 males and 5 females aged from 17 to 41 years and the course ranged from 21 days to 3 months. Patients who had symptoms of febrile and headache, positive meninges excitation, positive latex agglutination of cryptococcus of cerebrospinal fluid and positive ink smear were selected in this study. All patients provided informed consent. METHODS: Eight patients were treated with the fluconazole and intrathecal injection of amphotericin B. ① Intracranial hypertension of patients was controlled with flowing cerebrospinal fluid by repeatedly piercing waist; meanwhile, patients were taken the intrathecal injection of amphotericin B combining with flucytosine or fluconazole treatment. The dosage of amphotericin B was 1-5 mg/d at the beginning of administration, and then, the samples were added with 2 mg dexasine and 500 mL 5% glucose solution. The dosage was increased 5.0 mg per day till 50 mg per day, and the total dosage was 3.0-4.0 g. In addition, 2 mg dexasine was mixed with 4.0-5.0 mL cerebrospinal fluid, and then the solution was gradually injected into sheath for once a week. Fluconazole was dripped into vein with the volume of 400 mg per day, and then, 14 days later, fluconazole was orally taken by patients. ② Other therapies, such as decreasing intracranial hypertension, were used at the same time of administration. When cryptococcus of cerebrospinal fluid was negative, patients received the secondary therapy at anaphase. The drug withdrawal was not performed untill ink smear of cerebrospinal fluid was negative for 3 successive cultures. ③ Evaluative criteria: Evaluative criteria were classified into 4 styles: Cure: Clinical symptoms and physical signs disappeared and ink smear of cerebrospinal fluid was negative for 3 successful cultures; Improvement: Clinical symptoms and physical signs were improved remarkably, amount of cerebrospinal fluid was decreased, and ink smear was not negative; inefficiency and death. MAIN OUTCOME MEASURE: Clinical effects and poor responses of intrathecal injection of amphotericin B and fluconazole treatment. RESULTS: Among 8 patients with cryptococcal meningitis, one died due to intracranial hypertension combining with cerebral hernia, and others were returned visit at 1 year after drug withdrawal. ① Clinical effects: Among 8 patients with cryptococcal meningitis, 4 were cured, 3 were improved, and one died. There was no relapse case. ② Results of mycological examination: After first intrathecal injection of 4 improved patients, the amount of cryptococcus of cerebrospinal fluid was decreased 20%-30%; in addition, after intrathecal injection for twice or three times, the amount was decreased 33%-50%. ③ Improvement of intracranial hypertension: Seven patients had the intracranial hypertension. After intrathecal injection for twice or three times, pressure of cerebrospinal fluid was decreased below 2 451.75 Pa, and the clinical symptoms were relieved remarkably. ④ Poor responses: After intrathecal injection, patients had headache, nausea, emesis and pain of lower limb. Especially, 2 cases had transient paraplegia of both lower limbs, one had retention of urine, and two had conscious disturbance. CONCLUSION: Controlling intracranial hypertension with repeatedly piercing waist and intrathecal injection of amphotericin B combining with fluconazole treatment are well therapeutic effects on the fluconazole treatment of cryptococcal meningitis. Healing rate is 50%; however, there are a lot of poor responses at various degrees.
文摘Rationale:Cryptococcal infections commonly occur in immunosuppressed patients and are uncommon in immunocompetent persons.Patient concerns:A 32 year old lady,active smoker presented with right chest pain,dry cough and loss of weight.Initial chest radiograph showed a lobulated lung mass in the right lower lobe.She developed headache and right cranial nerve palsy during admission.Various investigations were done including lumbar puncture,brain and chest imaging.Diagnosis:Cryptococcal meningitis with pulmonary cryptococcoma.Interventions:She received five months of effective antifungal treatment;however,the patient did not respond well.Subsequently,removal of pulmonary cryptococcoma was done.Outcomes:Her condition improved and she no longer had any headache.Lessons:Disseminated cryptococcosis is rare in immunocompetent patient.Our case highlights the importance of high index of suspicion and we postulate that lobectomy helped in reducing the cryptococcal burden in her body,thus facilitating better response to antifungal therapy.
文摘BACKGROUND Aseptic meningitis is defined as meningeal inflammation caused by various etio-logies with negative cerebrospinal fluid(CSF)bacterial culture.The most common etiologies are viruses[enteroviruses,arboviruses,and herpes simplex virus type 2(HSV-2)].Aseptic meningitis can have various presentations,including sensori-neural deafness.While sensorineural deafness from mumps meningoencephalitis has been reported,cases of HSV-2-induced hearing loss are rare.Herein,we re-port a case of HSV-2-induced meningitis that presented with sudden deafness.CASE SUMMARY A 68-year-old man experienced a profound sudden onset of left-sided hearing loss for one day.Pure-tone audiograms demonstrated sudden left-sided sensorineural hearing loss(thresholds 80-90 dB).After treatment with high-dose steroids for 1 week,he experienced an acute consciousness change with left hemiparesis.The laboratory data showed no significant abnormalities.Brain computed tomography without contrast and magnetic resonance imaging revealed no intracranial hemo-rrhage or obvious brain lesion.The CSF analysis and the Multiplex PCR panels showed HSV-2 positivity.Hence,under the diagnosis of herpes meningoenceph-alitis,acyclovir was prescribed and his symptoms gradually resolved.CONCLUSION This case report further demonstrates that a viral infection could be a cause of sudden sensorineural hearing loss.
文摘BACKGROUND Meningitis remains a significant source of mortality and morbidity,with an incidence of 1 per 100000 persons in the United States.Guidelines recommend obtaining blood cultures and cerebrospinal fluid(CSF)studies in patients presenting with acute meningitis syndrome,and beginning treatment with broad spectrum antibiotics based on the age and certain predisposing conditions.In some patients however,the diagnostic lumbar puncture(LP)is not performed due to a multitude of reasons,ranging from increased intracranial pressure to failed attempt.In such situations,appropriate therapy is initiated empirically and often continued without establishment of a definitive diagnosis.AIM To determine whether a diagnostic LP in acute meningitis syndrome was associated with a better outcome and less duration of antibiotic therapy,along with potential causes for deferral of procedure.METHODS A retrospective study was conducted amongst the patients presenting to a 360 bedded community hospital in central Massachusetts with a diagnosis of acute meningitis syndrome between January 2010-September 2022.The electronic health records were accessed to collect necessary demographic and clinical data,including etiology of meningitis,lumbar puncture results,reason for procedure deferral,duration of antibiotic therapy and clinical outcome.The patients were subsequently divided into two groups based on whether they received a LP or not,and data was analyzed.RESULTS A total of 169 patients admitted with acute meningitis syndrome between September 2010-2022 were included in the study.The mean age of the participants was 54.3 years(SD+/-19.2 years).LP was performed for 130(76.9%)participants,out of which,28(21.5%)showed some growth in CSF culture.The most commonly identified organism was streptococcus pneumoniae.Amongst the 39 patients in whom LP was deferred,the major reasons recorded were:Body habitus(n=6,15.4%),and unsuccessful attempt(n=4,10.3%).While 93(71.5%)patients with LP received antibiotic therapy,only 19(48.7%)patients without LP received the antibiotics,with the principal reason being spontaneous improvement in sensorium without any diagnosed source of infection.The mean duration of antibiotic use was 12.3 days(SD+/-5.6)in the LP group and 11.5 days(SD+/-7.0)in the non-LP group(P=0.56;statistically not significant).We observed higher long term sequalae in the non-LP group(n=6,15.4%)compared to the LP group(n=9,6.9%).Similarly,the death rate was higher in the non-LP group(n=7,18.0%)compared to the LP group(n=9,6.9%).CONCLUSION LP remains the cornerstone for diagnosing meningitis,but often CSF results are unavailable,leading to empiric treatment.Our study identified that body habitus and unsuccessful attempts were the most common reasons for LP not being performed,leading to empiric antibiotic coverage.There was no difference between the duration of antibiotics received by the two groups,but a lower proportion of patients without LP received antibiotics,attributed to a spontaneous improvement in sensorium.However,the residual neurological sequelae and death rates were higher in patients without LP,signifying a potential under-treatment.A LP remains crucial to diagnose meningitis,and a lack of CSF analysis predisposes to under-treatment,leading to higher neurological sequelae and increased chances of death.
文摘Objective:To evaluate laboratory findings that predict bacterial meningitis in emergency service and their diagnostic effectiveness.Methods:This retrospective cohort study analyzed data from patients presenting with meningitis symptoms at a referral hospital in Mersin,Turkey,between January 2019 and January 2022.Clinical findings and laboratory results,including leukocyte count,C-reactive protein(CRP),and procalcitonin levels in blood,were examined.Logistic regression,Chi square test,and receiver operating characteristics(ROC)curve analyses assessed the predictive value of these parameters.Results:A total of 199 participants were included in the study;99 patients were diagnosed with meningitis after lumbar puncture and 100 served as controls.Patients with meningitis exhibited significantly higher leukocyte counts(median:11890×10^(3)/μL vs.7905×10^(3)/μL,P<0.001)and CRP levels(median:6.00 mg/dL vs.0.95 mg/dL,P<0.001)compared to controls.Procalcitonin levels were significantly elevated in meningitis patients(median:0.21 ng/mL vs.0.10 ng/mL,P<0.001).Logistic regression identified albumin(OR=0.16,95%CI=0.06-0.40),and CRP(OR=1.18,95%CI=1.08-1.28)as independent predictors of meningitis.ROC analysis for CRP demonstrated a sensitivity of 80.6%and specificity of 70.0%at a cut-off value of 2.23 mg/dL(AUC=0.792).Conclusions:Elevated albumin levels and CRP contents in the blood were significant predictors of meningitis in emergency service.Early identification of predictive markers may aid in timely lumbar puncture and management of atypical cases.
基金supported by National Natural Science Foundation of China,China(32170102)Natural Science Foundation of Tianjin(21JCYBJC01420)the Fundamental Research Funds for the Central Universities(63233050)。
文摘Objective Pseudomonas aeruginosa(P.aeruginosa)is a prevalent pathogenic bacterium involved in meningitis;however,the virulence factors contributing to this disease remain poorly understood.Methods The virulence of the P.aeruginosa A584,isolated from meningitis samples,was evaluated by constructing in vitro blood-brain barrier and in vivo systemic infection models.qPCR,whole-genome sequencing,and drug efflux assays of A584 were performed to analyze the virulence factors.Results Genomic sequencing showed that A584 formed a phylogenetic cluster with the reference strains NY7610,DDRC3,Pa58,and Pa124.Its genome includes abundant virulence factors,such as hemolysin,the Type IV secretion system,and pyoverdine.A584 is a multidrug-resistant strain,and its wide-spectrum resistance is associated with enhanced drug efflux.Moreover,this strain caused significantly more severe damage to the blood-brain barrier than the standard strain,PAO1.qPCR assays further revealed the downregulation of the blood-brain barrier-associated proteins Claudin-5 and Occludin by A584.During systemic infection,A584 exhibited a higher capacity of brain colonization than PAO1(37.1×10^(6) CFU/g brain versus 2.5×10^(6) CFU/g brain),leading to higher levels of the proinflammatory factors IL-1βand TNF-α.Conclusion This study sheds light on the virulence factors of P.aeruginosa involved in meningitis.
基金supported by the National Key Research and Development Program of China(2021FYD1800405)the National Natural Science Foundation of China(32072823).
文摘Streptococcus suis serotype 2(SS2)is an emerging zoonotic pathogen that causes meningitis in humans and pigs.This pathogen generates substantial economic losses in the swine industry while posing a significant threat to public health security.The mechanisms through which SS2 penetrates the brain and induces meningitis remain incompletely understood.This study examines the role and mechanism of SS2 collagenase-like protease(Clp)in facilitating bacterial passage across the blood-brain barrier(BBB).The research demonstrates that SS2 Clp enhanced virulence and tissue colonization while promoting BBB degradation in mice.The Δclp mutant exhibited reduced ability to traverse human brain microvascular endothelial(hCMEC/D3)cell monolayers compared to wild-type SS2,while the addition of recombinant protein rClp increased permeability.Furthermore,rClp significantly enhanced SS2 adhesion to hCMEC/D3,suppressed the expression of intercellular tight junction proteins ZO-1,Occludin,and Claudin-5 independent of its enzyme activity,and triggered hCMEC/D3 apoptosis through cell receptor ligand apoptosis and mitochondrial apoptosis pathways,partially dependent on its enzyme activity,leading to BBB disruption and enhanced permeability.Additionally,Clp enhanced the infiltration of macrophages(F4/80+),monocytes(F4/80-Ly6C+),and neutrophils(Ly6G+)into the brain following SS2 infection.These findings establish that SS2 Clp is essential for bacterial passage across the BBB,offering a theoretical foundation for improved prevention and treatment strategies for SS2-induced meningitis.
文摘Background:Invasive meningococcal disease is a potentially life-threatening infection caused by Neisseria meningitidis.Vaccination is highly effective in preventing meningitis and reducing its associated complications.This study aims to assess the United Arab Emirates(UAE)parents meningitis knowledge and explore vaccination attitudes and practices.Methodology:An observational cross-sectional study was conducted between March and May 2024 across the UAE using convenience sampling through social media,electronic mail,and word of mouth.A 58-item questionnaire collected information regarding demographics,meningitis knowledge,attitudes and practices,and meningococcal vaccination knowledge and practices.Results:Of 443 parents included,more than a third had no knowledge about meningitis.Symptoms and severity were well-recognized overall,but clear gaps were evident regarding complications and meningococcal vaccines.Only 10.38%(46/443)identified themselves as knowledgeable/very knowledgeable regarding meningococcal vaccines.A healthcare provider recommendation was the strongest factor encouraging parents to vaccinate their child.Most vaccine hesitancy was seen regarding side effects.Views and practices regarding the two vaccines aligned closely,with more than four-fifths of participants needing more information and the major reasons for not vaccinating a child being a lack of information or lack of recommendation.Social media and governmental websites were the most common sources for learning more about meningitis,with doctors ranking third.In fact,trust in doctors varied with less than half having moderate or strong trust in their main paediatrician.Multivariate logistic regression revealed that coronavirus disease 2019 vaccination status[adjusted odds ratio(AOR):0.365,95%confidence interval(CI):0.172 to 0.774,P=0.013]and female gender(AOR:2.741,95%CI:1.184 to 6.347,P=0.019)were significant predictors of vaccine hesitancy.Conclusion:Meningococcal vaccine hesitancy is a significant concern,primarily driven by fears of side effects and lack of knowledge and physician recommendation.However,vaccine attitudes were overall positive and highly dependent on physician involvement.There is a need for targeted educational initiatives enhancing meningitis disease awareness and vaccine uptake.
基金financially supported by the National Natural Science Foundation of China(No.32172855)Fundamental Research Funds for the Central Universities(Nos.2632024ZD07,2632024TD02)the Open Project of Jiangsu Provincial Science and Technology Resources(Clinical Resources)Coordination Service Platform(No.TC2023B001)。
文摘The presence of the blood–brain barrier limits the drug concentration in the brain,while low concentrations of antibiotics make it difficult to kill infecting bacteria and tends to induce drug resistance,making the clinical treatment of bacterial meningitis challenging.Herein,a nose-to-brain delivery strategy of small-sized nanozyme has been fabricated for combating bacterial meningitis,to overcome the low drug concentration and drug resistance.This strategy was achieved by a proteinsupported Au nanozyme(ANZ).With a particle size of less than 10 nm,it possesses both glucose oxidase-like and peroxidase-like activities and can generate large amounts of reactive oxygen species through a cascade effect without the addition of external H_(2)O_(2).Benefiting from the cascade catalytic amplification effect generated by its dual enzymelike activities,ANZ shows significant broad-spectrum antibacterial activity without inducing bacterial resistance in vitro.Notably,small-sized ANZ exhibits higher brain entry efficiency and greater accumulation after intranasal administration compared to oral or intravenous administration.In a mouse model of bacterial meningitis,the mice treated with ANZ had lower bacterial loads in the brain and higher survival and clinical behavior scores compared to the classical antibiotic ceftriaxone.Additionally,the meningitis mice exhibited undamaged cognitive and behavioral abilities,indicating the excellent biocompatibility of ANZ.The above results demonstrate that nose-to-brain delivery of ANZ exhibits high intracerebral accumulation,strong antibacterial efficacy and does not lead to bacterial resistance.It holds broad prospects for the treatment of bacterial meningitis.
文摘BACKGROUND The World Health Organization(WHO)recommends lumbar puncture(LP)procedures to assess the diagnosis of cryptococcal meningitis(CM)among patients with advanced human immunodeficiency virus(HIV)disease(AHD)with positive serum cryptococcal antigen(CrAg)and do not have evidence of CM.AIM To estimate pooled prevalence of uptake of LP,CM and mortality among patients with AHD.METHODS PubMed,Cochrane Library and EMBASE were searched for articles published between January 2011 and December 2024.LP uptake was defined as percentage of people who underwent LP procedures among those with AHD(CD4≤200 cells/mm3 or WHO stage III/IV)and positive serum CrAg.Using random effects models,we computed the pooled estimate of LP uptake,CM and mortality and 95%CI.Stratified analyses were used to compare uptake of LP between studies that involved multiple vs single sites,and mortality analyses between patients with positive and negative serum CrAg were performed.Sensitivity analysis on LP uptake was done by excluding prospective cohort studies that reported 100%uptake.RESULTS A total of 32 studies with 46890 people with AHD screened for serum CrAg and 2730(5.8%)had positive serum CrAg.Overall,pooled prevalence of LP uptake was 67.7%(95%CI:54.0-81.5).The overall pooled prevalence of CM was 54.3%(95%CI:39.7-69.0),and mortality was 6.2%(95%CI:4.5-8.0).There is disparities in the pooled prevalence of LP uptake with studies involving multiple sites having lower prevalence compared to those that involved single sites(54.8%vs 84.7%,P=0.004).By excluding prospective cohort studies that reported 100%uptake,the overall LP uptake was 54.5%(95%CI:38.8-70.1).The pooled prevalence of CM was significantly lower among studies that involved multiple sites compared to those that involved single sites(6.8%vs 8.1%,P≤0.001).Mortality was significantly twice as high among patients who had positive serum CrAg compared to those who had negative serum CrAg[risk ratio=2.0(95%CI:1.6-2.5),P≤0.001].CONCLUSION Nearly three to five in 10 people with AHD with positive serum CrAg did not have LP procedures done,indicating significant gaps in identifying patients with CM.Establishing a confirmed diagnosis of CM is critical to avoid exposing patients to subtherapeutic levels of antifungals preemptively.Capacity to perform LP and patient refusals are among the reasons for not performing the procedure.Capacity building in training health care providers to perform LP procedures and professional counselling to obtain patient consent are critical for appropriate treatment to reduce mortality associated with CM infection.
文摘Tuberculous meningitis(TBM),which accounts for 1%-5%of global tuberculosis cases,is a severe neurological infection with a mortality rate of 30%-50%.Its high fatality and disability rates disproportionately affect low-and middle-income regions(e.g.,sub-Saharan Africa and Southeast Asia),threatening the lives of patients and imposing significant psychosocial burdens.Recent studies have highlighted the crucial role of psychosocial factors,including socioeconomic status,disease severity,and social support systems in recovery.However,research gaps persist in developing TBM-specific psychosocial interventions.This narrative review summarizes and organizes the key findings of observational studies,cohort studies,and intervention trials published between 2015 and 2024.Databases including PubMed,Scopus,and Web of Science were searched for terms related to TBM,psychosocial risk factors and mental health interventions.Studies were screened for relevance and quality,focusing on those that examined the psychological and social determinants of mental health outcomes in patients with TBM.
文摘Background Amphotericin B （0.7 mg/kg） with flucytosine is the standard treatment for cryptococcal meningitis.However,the long treatment course can induce adverse reactions in patients; therefore,reducing the dose may decrease such reactions.We performed a retrospective analysis of treatment effects and adverse reactions when amphotericin B （0.4 mg/kg or 0.7 mg/kg per day） and flucytosine were used together to treat HIV-negative patients with cryptococcal meningitis.Methods Retrospective analysis was conducted on inpatients at the First Affiliated Hospital,College of Medicine,Zhejiang University （January 2005 to December 2009）.Low- or high-dose amphotericin B （0.4 or 0.7 mg/kg per day,respectively） plus flucytosine was used.The negative conversion rate of Cryptococcus in the cerebrospinal fluid （CSF）,patient mortality,and the incidence of side effects for the two groups （low- vs.high-dose） were compared immediately after treatment and 2 and 10 weeks later.Data were analyzed by the Student＇s t test,chi-square tests using SPSS 12.0 statistical soitware.Results Two weeks post-treatment,Cryptococcus negative CSF rates were 78% （18/23） in the low-dose group and 87% （13/15） in the high-dose group （P=0.28）.Ten weeks post-treatment,both groups were negative.The mortality rate was 8% （2/25） in the low-dose group and 17% （3/18） in the high-dose group （P=-0.25）.There was a statistically significant difference in the incidence of adverse events between the groups,48% （12/25） and 78% （14/18） in the low- and high-dose groups,respectively （P=0.04）.Adverse events that required a change in treatment program in the low-dose group were 12% （3/25） compared to 39% （7/18） in the high-dose group （P=-0.04）.Conclusion Low-dose treatment regimens were better tolerated
文摘Cryptococcus neoformans （C. neoformans） is the most common cause of fungal meningitis worldwide.1 Cryptococcal meningitis is an opportunistic infection commonly found in immunocompromised hosts, especially HIV-infected adults. It also occurs in apparently immunocompetent individuals. Rarely has it been reported in children, and it is almost nonexistent in infants. Voriconazole is a member of a second generation of antifungal triazoles with broad spectrum antifungal activity, oral and parenteral bioavailability and a favorable safety profile in adults.3 This patient shows improved in vitro activity against C. neoformans when compared to fluconazole and it has been used successfully in about half the patients with refractory cryptococcosis.4 However, the efficacy and safety of voriconazole as a antifungal agent in children with cryptococcal meningitis have not been well assessed, This report described cryptococcal meningitis in a 13-day-old premature neonate who recovered without overt toxicity after voriconazole was added to an antifungal regimen that included amphotericin B and flucytosine. We focused on the response of this child with cryptococcal meningitis to voriconazole.
文摘Objective To compare the curative effects of three different antifungal regimens in the treatment of cryptococcal meningitis Methods Twenty two patients were divided into 3 groups: Group Ⅰ was given intravenous amphotericin B alone or combination with flucytosine therapy Group Ⅱ received intravenous fluconazole alone or combination with flucytosine The treatment of Group Ⅲ was divided into two steps, where the patients received intrathecal amphotericin B plus intravenous amphotericin B with or without intravenous fluconazole until the mycological culture of cerebrospinal fluid (CSF) turned negative, followed by oral fluconazole or itraconazole as maintenance therapy until direct microscopic examination of CSF showed negative once a week for three consecutive weeks Results Of the twenty two patients, 17 (77 3%) were cured, 2 (9 1%) improved, 3 (13 6%) died, and one (4 5%) relapsed Of the 8 patients in Group Ⅰ, 5 were cured, 2 improved, one died and one relapsed; Of the 4 patients in Group Ⅱ, 2 were cured, and 2 died; All the 10 patients in Group Ⅲ were cured without any recurrence Conclusion The two step therapeutic regimen may be suited to the treatment of cryptococcal meningitis
文摘Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
文摘In the non-human immunodeficiency virus infected population,cryptococcosis occurs primarily in people who are functionally immunosuppressed,including patients who have undergone solid organ transplantation requiring immunosuppressive medications,are on corticosteroids,or have renal failure or cirrhosis.Cryptococcal meningitis poses a particular challenge in the setting of cirrhosis because its clinical presentation can mimic hepatic encephalopathy.Here,we describe two patients with decompensated cirrhosis,both with a known history of hepatic encephalopathy who had lumbar punctures and were found to have cryptococcal meningitis.The first patient had a subacute fluctuating change in mental status,while the second patient had progressive subacute headaches,gait disturbance,and hearing loss.Both patients were treated with amphotericin B and flucytosine induction,but only the second survived to maintenance therapy.These cases demonstrate the importance of having a high index of suspicion for cryptococcal meningitis in cirrhosis and having a low threshold for performing a lumbar puncture when altered mental status or other neurologic complaints are not fully explained by hepatic encephalopathy.We also provide a brief review of the pathobiology of cryptococcal infection in cirrhosis and highlight the challenges in therapy.
