Pentatricopeptide repeat(PPR)proteins are a large group of eukaryote-specific RNA-binding proteins that play pivotal roles in plant organelle gene expression.Here,we report the function of PPR21 in mitochondrial intro...Pentatricopeptide repeat(PPR)proteins are a large group of eukaryote-specific RNA-binding proteins that play pivotal roles in plant organelle gene expression.Here,we report the function of PPR21 in mitochondrial intron splicing and its role in maize kernel development.PPR21 is a typical P-type PPR protein targeted to mitochondria.The ppr21 mutants are arrested in embryogenesis and endosperm development,leading to embryo lethality.Null mutations of PPR21 reduce the splicing efficiency of nad2 intron 1,2,and 4 and impair the assembly and activity of mitochondrial complex I.Previous studies show that the P-type PPR protein EMP12 is required for the splicing of identical introns.However,our protein interaction analyses reveal that PPR21 does not interact with EMP12.Instead,both PPR21 and EMP12 interact with the small MutS-related(SMR)domain-containing PPR protein 1(PPR-SMR1)and the short P-type PPR protein 2(SPR2).PPR-SMR1 interacts with SPR2,and both proteins are required for the splicing of many introns in mitochondria,including nad2 intron 1,2,and 4.These results suggest that a PPR21-(PPR-SMR1/SPR2)-EMP12 complex is involved in the splicing of nad2 introns in maize mitochondria.展开更多
Linear mRNA vaccines are constrained by exonuclease susceptibility and instability,leading to compromised antigen expression.Circular RNA(circRNA) lacking canonical 5' and 3' untranslated regions demonstrates ...Linear mRNA vaccines are constrained by exonuclease susceptibility and instability,leading to compromised antigen expression.Circular RNA(circRNA) lacking canonical 5' and 3' untranslated regions demonstrates intrinsic exonuclease resistance.Current circularization strategies face three principal limitations:chemical methods produce non-native 2',5'-phosphodiester bonds;ribozyme-mediated approaches are restricted to RNA fragments shorter than 500 nucleotides;the Anabaena Group I intron system retains immunogenic exon sequences.In contrast,the self-splicing Group I intron ribozyme from Tetrahymena enables precisely controlled circularization through autonomous structural rearrangement,yielding exonfree constructs.Through optimized purification protocols,historical scalability challenges are systematically addressed.This Perspective establishes the mechanistic rationale and therapeutic superiority of this engineered RNA circularization platform.展开更多
There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of wa...There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of waxy gene intron 1 and amylose content in rice, the one-step PCR method was used to determine whether it is G or T in 220 Yunnan indigenous rice varieties from 14 districts, 55 towns/counties of Yunnan Province, and 101 varieties of which were validated by the PCR-Acc I method. According to the G/T polymorphism, 164 rice varieties showed GG-genotype, while the other 56 fell into TT- genotype, accounting for 74.5% and 25.5% of all the test varieties, respectively. When all the rice varieties were divided into indica and japonica subspecies, it was found that 80.5% of indica rice and 67.0% of japonica rice belonged to GG-genotype. The rice varieties with GG-genotype had significantly higher amylose content (18.95% on average) than those with TT- genotype (all below 16%), but 33 rice varieties with GG-genotype still had low amylose content ranging from 3.91% to 15.93%, and most of them came from the Dai minority area in the Southwest of Yunnan Province. However, there was no significant difference in the mean amylose content of the same GG or TT genotypes between indica and japonica rice, suggesting that different genetic backgrounds, indica or japonica, had no effect on amylose content. The coefficient of correlation between the genotype and amylose content was 0.733 (P〈0.01).展开更多
This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of P...This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.展开更多
AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squa...AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squamous cell carcinoma(ESCC) obtained from a university hospital in Songkhla province,Southern Thailand were investigated for p53 mutations in exons 5-8,using polymerase chain reaction-single strand conformation polymorphism analysis,followed by direct sequencing.A polymerase chain reactionrestriction fragment length polymorphism(RFLP) assay was additionally used to confirm possible germline mutation in intron 6.A history of risk habits was obtained by interviews.The association between risk habits and mutation frequency was evaluated using the χ 2 test.RESULTS:The studied specimens were from 139 male and 26 female patients with ESCC,treated at Songklanagarind Hospital.Most of the patients were smokers(86.7%) and alcohol consumers(72.73%),and 38.3% were betel chewers.Forty-three mutations of the p53 gene were detected in 25.5%(42/165) of tumor samples.Mutations were most commonly found in exon 5(25.6%) and exon 8(25.6%).Mutations in the hot-spot codon 248 were found in four cases(9.3% of all mutations).G:C→C:G(30.23%),G:C→A:T(27.90%) and G:C →T:A(16.28%) were the prevalent spectra of mutations.Unexpectedly,among 10 intronic mutations,eight cases harbored a similar mutation:G→C substitution in intron 6(nucleotide 12759,GenBank NC_000017).These were additionally confirmed by the RFLP technique.Similar mutations were also detected in their matched blood samples using RFLP and direct sequencing,which suggested germline mutations.There was no significant correlation between risk habits and p53 mutation frequency.CONCLUSION:A proportion of Thai ESCC patients harbored specific intronic p53 mutations,which might be germline mutations.Further studies are needed to explore this novel finding.展开更多
To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ (intron targeted intron-exon splice junction) primer combinations, which were designed acc...To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ (intron targeted intron-exon splice junction) primer combinations, which were designed according to the intronexon splice junction conserved sequences, were used to construct cotton genetic linkage map in the present study. 49 out of 704 IT-ISJ primer combinations showed polymorphism between upland cotton high quality cultivar Yumian 1 and multiple dominant gene line T586, and the polymorphic primer combinations accounted for 7.0% of total primer combinations. 49 IT-ISJ primer combinations were used to genotype 270 F2:7 recombinant inbred lines developed from (Yumian 1 × T586) F2, and 58 IT-ISJ loci were obtained. 58 IT-ISJ, together with 150 SSR and 8 morphological loci, were used to conduct linkage analysis, and a linkage map including 22 linkage groups and 113 loci (49 IT-ISJ, 62 SSR, and 2 morphological loci) was constructed. The linkage map covered 714.5 cM with an average interval of 6.3 cM between two markers, accounting for 16.1% of cotton genome. The present study demonstrated that the polymorphism of IT-ISJ marker is high, and it could be effectively applied in plant genetic map construction.展开更多
Genetic composition plays critical roles in the pathogenesis of autism spectrum disorder(ASD).Especially,inherited and de novo intronic variants are often seen in patients with ASD.However,the biological significance ...Genetic composition plays critical roles in the pathogenesis of autism spectrum disorder(ASD).Especially,inherited and de novo intronic variants are often seen in patients with ASD.However,the biological significance of intronic variants is difficult to address.Here,among a Chinese ASD cohort,we identified a recurrent inherited intronic variant in the CHD7 gene,which is specifically enriched in East Asian populations.CHD7 has been implicated in numerous developmental disorders including CHARGE syndrome and ASD.To investigate whether the ASD-associated CHD7 intronic variant affects neural development,we established human embryonic stem cells carrying this variant using CRISPR/Cas9 methods and found that the level of CHD7 mRNA significantly decreased compared to control.Upon differentiation towards the forebrain neuronal lineage,we found that neural cells carrying the CHD7 intronic variant exhibited developmental delay and maturity defects.Importantly,we found that TBR1,a gene also implicated in ASD,was significantly increased in neurons carrying the CHD7 intronic variant,suggesting the intrinsic relevance among ASD genes.Furthermore,the morphological defects found in neurons carrying CHD7 intronic mutations were rescued by knocking down TBR1,indicating that TBR1 may be responsible for the defects in CHD7-related disorders.Finally,the CHD7 intronic variant generated three abnormal forms of transcripts through alternative splicing,which all exhibited loss-of-function in functional assays.Our study provides crucial evidence supporting the notion that the intronic variant of CHD7 is potentially an autism susceptibility site,shedding new light on identifying the functions of intronic variants in genetic studies of autism.展开更多
The exon numbers and lengths vary in different eukaryotic species. With increasing completed genomic sequences, it is indispensable to reanalyze the gene organization in diverse eukaryotic genomes. We performed a larg...The exon numbers and lengths vary in different eukaryotic species. With increasing completed genomic sequences, it is indispensable to reanalyze the gene organization in diverse eukaryotic genomes. We performed a large-scale comparative analysis of the exon-intron structure in 72 eukaryotic organisms, including plants, fungi and animals. We confirmed that the exon-intron structure varies massively among eukaryotic genomes and revealed some lineage-specific features of eukaryotic genes. These include a teleost-specific exon-intron structure pattern, relatively small introns and large exons in fungi and algae, and a gradual expansion of introns in vertebrates. Furthermore, the conservation analysis of exon-intron boundaries indicates that several bases near splice site junctions are different in introns with variable length among different species. After comparison, we identified a trend showing increases in intron densities and lengths in diverse species from fungi, plants, invertebrates to vertebrates, while it was the opposite in relation to exon lengths. The statistical properties of eukaryotic genomic organization suggest that genome-specific features are preserved by diverse evolutionary processes, which paves way for further research on the diversification of eukaryotic evolution.展开更多
Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the pre...Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the present study, we developed a set of polymorphic intron-spanning markers(ISMs) using a cross-species mapping approach. In this approach, putative unique transcripts(PUTs) of L. culinaris were mapped onto the Medicago truncatula genome, exploiting its closeness with the lentil genome. Spliced alignment of the PUTs resulted in a total of 25,717 alignments, allowing the development of 1703 ISMs. From these, a subset of 105 ISMs were synthesized and validated with a 51% amplification success rate in 32 lentil genotypes. Of these ISMs, 40(74%) were polymorphic and generated 2–11 alleles per locus in a genetically diverse panel of 32 lentil genotypes including wild species.This set of polymorphic ISMs along with their functional annotation data will be useful in lentil breeding.展开更多
In the alternative splicing, intron retention, of histamine H3 receptors in rats and mice, the short transcript isoforms that are excised alternatively spliced introns are easily detected in a very low level in rats a...In the alternative splicing, intron retention, of histamine H3 receptors in rats and mice, the short transcript isoforms that are excised alternatively spliced introns are easily detected in a very low level in rats and are undetectable in mice using the regular PCR protocol. The retained introns have common 5' splice site and different 3' splice sites. The detailed mechanism for the special alternative splicing remains largely unclear. In this study, we developed a minigene splicing system to recapitulate natural alternative splicing of the receptors and investigated the effects of 5' and 3' splice sites on intron retention in HeLa cells. Mutating weak 5' and 3' splice sites of the alternatively spliced introns toward the canonical consensus sequences promoted the splicing of the corresponding introns in rat and mouse minigenes. The effect of splice site strength was context-dependent and much more sigiaificant for the 3' splice site of the longer alternative intron than for the 3' splice site of the shorter alternative intron and the common 5' splice sites; it was also more significant in the rat minigene than in the mouse minigene. Mutating the 3' splice site of the longer alternative intron resulted in almost complete splicing of the intron and made the corresponding isoform to become the nearly exclusive transcript in the rat minigene.展开更多
Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment ba...Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment based on the principle that 81bp intron sequencewas deleted in PC mRNA compared with PC DNA sequence. The 466bp competitive DNA templaterecombinant plasmid of PC mRNA was successfully built by a pair of primer and was clonedonce, PC DNA and PC mRNA could be inter-referred each other. The intron approach used inthe experiment has broken through the traditional method of constructing competitivetemplate.展开更多
Intronic polyadenylation(IPA)is an RNA 3'end processing event which has been reported to play important roles in cancer development.However,the comprehensive landscape of IPA events across various cancer types is ...Intronic polyadenylation(IPA)is an RNA 3'end processing event which has been reported to play important roles in cancer development.However,the comprehensive landscape of IPA events across various cancer types is lacking.Here,we apply IPAFinder to identify and quantify IPA events in 10,383 samples covering all 33 cancer types from The Cancer Genome Atlas(TCGA)project.We identify a total of 21,835 IPA events,almost half of which are ubiquitously expressed.We identify 2761 unique dynamically changed IPA events across cancer types.Furthermore,we observe 8855 non-redundant clinically relevant IPA events,which could potentially be used as prognostic indicators.Our analysis also reveals that dynamic IPA usage within cancer signaling pathways may affect drug response.Finally,we develop a user-friendly data portal,IPACancer Atlas(http://www.tingni-lab.com/Pancan_IPA),to search and explore IPAs in cancer.展开更多
基金supported by the National Natural Science Foundation of China(32072126 and 32230075)the Shandong Provincial Natural Science Foundation(ZR2019MC005).
文摘Pentatricopeptide repeat(PPR)proteins are a large group of eukaryote-specific RNA-binding proteins that play pivotal roles in plant organelle gene expression.Here,we report the function of PPR21 in mitochondrial intron splicing and its role in maize kernel development.PPR21 is a typical P-type PPR protein targeted to mitochondria.The ppr21 mutants are arrested in embryogenesis and endosperm development,leading to embryo lethality.Null mutations of PPR21 reduce the splicing efficiency of nad2 intron 1,2,and 4 and impair the assembly and activity of mitochondrial complex I.Previous studies show that the P-type PPR protein EMP12 is required for the splicing of identical introns.However,our protein interaction analyses reveal that PPR21 does not interact with EMP12.Instead,both PPR21 and EMP12 interact with the small MutS-related(SMR)domain-containing PPR protein 1(PPR-SMR1)and the short P-type PPR protein 2(SPR2).PPR-SMR1 interacts with SPR2,and both proteins are required for the splicing of many introns in mitochondria,including nad2 intron 1,2,and 4.These results suggest that a PPR21-(PPR-SMR1/SPR2)-EMP12 complex is involved in the splicing of nad2 introns in maize mitochondria.
基金supported by the National Key Research&Development Program of China(Nos.2021YFC2302400,2021YFA1201000,2023YFC2606004)the Fundamental Research Funds for the Central Universities(No.2022CX01013)。
文摘Linear mRNA vaccines are constrained by exonuclease susceptibility and instability,leading to compromised antigen expression.Circular RNA(circRNA) lacking canonical 5' and 3' untranslated regions demonstrates intrinsic exonuclease resistance.Current circularization strategies face three principal limitations:chemical methods produce non-native 2',5'-phosphodiester bonds;ribozyme-mediated approaches are restricted to RNA fragments shorter than 500 nucleotides;the Anabaena Group I intron system retains immunogenic exon sequences.In contrast,the self-splicing Group I intron ribozyme from Tetrahymena enables precisely controlled circularization through autonomous structural rearrangement,yielding exonfree constructs.Through optimized purification protocols,historical scalability challenges are systematically addressed.This Perspective establishes the mechanistic rationale and therapeutic superiority of this engineered RNA circularization platform.
文摘There exists a single nucleotide polymorphism, G or T, at the first base of the donor splice site of waxy gene intron 1 in rice. In order to study the relationship between the first base of the donor splice site of waxy gene intron 1 and amylose content in rice, the one-step PCR method was used to determine whether it is G or T in 220 Yunnan indigenous rice varieties from 14 districts, 55 towns/counties of Yunnan Province, and 101 varieties of which were validated by the PCR-Acc I method. According to the G/T polymorphism, 164 rice varieties showed GG-genotype, while the other 56 fell into TT- genotype, accounting for 74.5% and 25.5% of all the test varieties, respectively. When all the rice varieties were divided into indica and japonica subspecies, it was found that 80.5% of indica rice and 67.0% of japonica rice belonged to GG-genotype. The rice varieties with GG-genotype had significantly higher amylose content (18.95% on average) than those with TT- genotype (all below 16%), but 33 rice varieties with GG-genotype still had low amylose content ranging from 3.91% to 15.93%, and most of them came from the Dai minority area in the Southwest of Yunnan Province. However, there was no significant difference in the mean amylose content of the same GG or TT genotypes between indica and japonica rice, suggesting that different genetic backgrounds, indica or japonica, had no effect on amylose content. The coefficient of correlation between the genotype and amylose content was 0.733 (P〈0.01).
文摘This study describes variation of intron-3 of α-amylase gene from 156 breeds of adzuki beans using SSCP(single-strand conformation polymorphism)analysis. Based on α-amylase gene structure and sequence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT) were designed to amplify intron-3 fragments of α-amylase gene. 14 variant types were detected, including 13, 9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively, 9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other variant types in the local adzuki beans from China and Bhutan. 60% of subjects of cultivated races were found to be EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 variant types reveals the evolution process of various variant types in adzuki beans.
基金Supported by The Annual Research Fund of the National Research Council of Thailand
文摘AIM:To investigate p53 mutations in esophageal cancer in a high-risk population,and correlate them with smoking,alcohol consumption and betel chewing.METHODS:One hundred and sixty-five tumor samples of esophageal squamous cell carcinoma(ESCC) obtained from a university hospital in Songkhla province,Southern Thailand were investigated for p53 mutations in exons 5-8,using polymerase chain reaction-single strand conformation polymorphism analysis,followed by direct sequencing.A polymerase chain reactionrestriction fragment length polymorphism(RFLP) assay was additionally used to confirm possible germline mutation in intron 6.A history of risk habits was obtained by interviews.The association between risk habits and mutation frequency was evaluated using the χ 2 test.RESULTS:The studied specimens were from 139 male and 26 female patients with ESCC,treated at Songklanagarind Hospital.Most of the patients were smokers(86.7%) and alcohol consumers(72.73%),and 38.3% were betel chewers.Forty-three mutations of the p53 gene were detected in 25.5%(42/165) of tumor samples.Mutations were most commonly found in exon 5(25.6%) and exon 8(25.6%).Mutations in the hot-spot codon 248 were found in four cases(9.3% of all mutations).G:C→C:G(30.23%),G:C→A:T(27.90%) and G:C →T:A(16.28%) were the prevalent spectra of mutations.Unexpectedly,among 10 intronic mutations,eight cases harbored a similar mutation:G→C substitution in intron 6(nucleotide 12759,GenBank NC_000017).These were additionally confirmed by the RFLP technique.Similar mutations were also detected in their matched blood samples using RFLP and direct sequencing,which suggested germline mutations.There was no significant correlation between risk habits and p53 mutation frequency.CONCLUSION:A proportion of Thai ESCC patients harbored specific intronic p53 mutations,which might be germline mutations.Further studies are needed to explore this novel finding.
基金the National Natural Science Foundation of China (30370898,30571187, 30871556)National High Tech Research and Development Program of China (2006AA10Z1D3,2006AA100105)
文摘To develop a new DNA maker, which could be used in genetic diversity analysis and genetic map construction in plants, IT-ISJ (intron targeted intron-exon splice junction) primer combinations, which were designed according to the intronexon splice junction conserved sequences, were used to construct cotton genetic linkage map in the present study. 49 out of 704 IT-ISJ primer combinations showed polymorphism between upland cotton high quality cultivar Yumian 1 and multiple dominant gene line T586, and the polymorphic primer combinations accounted for 7.0% of total primer combinations. 49 IT-ISJ primer combinations were used to genotype 270 F2:7 recombinant inbred lines developed from (Yumian 1 × T586) F2, and 58 IT-ISJ loci were obtained. 58 IT-ISJ, together with 150 SSR and 8 morphological loci, were used to conduct linkage analysis, and a linkage map including 22 linkage groups and 113 loci (49 IT-ISJ, 62 SSR, and 2 morphological loci) was constructed. The linkage map covered 714.5 cM with an average interval of 6.3 cM between two markers, accounting for 16.1% of cotton genome. The present study demonstrated that the polymorphism of IT-ISJ marker is high, and it could be effectively applied in plant genetic map construction.
基金the National Key R&D Program of China(2018YFA0108000)the National Natural Science Foundation of China(31625013,81941405,31771137,31722024,91732302,and 32000726)+4 种基金a Shanghai Brain-Intelligence Project from the Science and Technology Commission of Shanghai Municipality(16JC1420501)the Strategic Priority Research Program of the Chinese Academy of Sciences(XDBS01060200 and XDA16010310)a Shanghai Municipal Science and Technology Major Project(2018SHZDZX05)the Shanghai Pujiang Program(17PJ1410200)the research was supported by the Open Large Infrastructure Research of the Chinese Academy of Sciences.
文摘Genetic composition plays critical roles in the pathogenesis of autism spectrum disorder(ASD).Especially,inherited and de novo intronic variants are often seen in patients with ASD.However,the biological significance of intronic variants is difficult to address.Here,among a Chinese ASD cohort,we identified a recurrent inherited intronic variant in the CHD7 gene,which is specifically enriched in East Asian populations.CHD7 has been implicated in numerous developmental disorders including CHARGE syndrome and ASD.To investigate whether the ASD-associated CHD7 intronic variant affects neural development,we established human embryonic stem cells carrying this variant using CRISPR/Cas9 methods and found that the level of CHD7 mRNA significantly decreased compared to control.Upon differentiation towards the forebrain neuronal lineage,we found that neural cells carrying the CHD7 intronic variant exhibited developmental delay and maturity defects.Importantly,we found that TBR1,a gene also implicated in ASD,was significantly increased in neurons carrying the CHD7 intronic variant,suggesting the intrinsic relevance among ASD genes.Furthermore,the morphological defects found in neurons carrying CHD7 intronic mutations were rescued by knocking down TBR1,indicating that TBR1 may be responsible for the defects in CHD7-related disorders.Finally,the CHD7 intronic variant generated three abnormal forms of transcripts through alternative splicing,which all exhibited loss-of-function in functional assays.Our study provides crucial evidence supporting the notion that the intronic variant of CHD7 is potentially an autism susceptibility site,shedding new light on identifying the functions of intronic variants in genetic studies of autism.
基金supported by the National Natural Science Fund of China (30970231)the Genetically Modified Organisms Breeding Major Project of China (2014ZX08003001)
文摘supported by the National Natural Science Fund of China (30970231);the Genetically Modified Organisms Breeding Major Project of China (2014ZX08003001)
文摘The exon numbers and lengths vary in different eukaryotic species. With increasing completed genomic sequences, it is indispensable to reanalyze the gene organization in diverse eukaryotic genomes. We performed a large-scale comparative analysis of the exon-intron structure in 72 eukaryotic organisms, including plants, fungi and animals. We confirmed that the exon-intron structure varies massively among eukaryotic genomes and revealed some lineage-specific features of eukaryotic genes. These include a teleost-specific exon-intron structure pattern, relatively small introns and large exons in fungi and algae, and a gradual expansion of introns in vertebrates. Furthermore, the conservation analysis of exon-intron boundaries indicates that several bases near splice site junctions are different in introns with variable length among different species. After comparison, we identified a trend showing increases in intron densities and lengths in diverse species from fungi, plants, invertebrates to vertebrates, while it was the opposite in relation to exon lengths. The statistical properties of eukaryotic genomic organization suggest that genome-specific features are preserved by diverse evolutionary processes, which paves way for further research on the diversification of eukaryotic evolution.
基金the Indian Council of Agricultural Research,New Delhi,India for research supportpartially funded by the Department of Biotechnology,Government of India,New Delhi,India through a grant support(BT/PR10921/AG11/106/943/2014)
文摘Lentil(Lens culinaris Medik) is one of the most important food legumes in the world. The use in lentil of molecular marker-assisted breeding is limited, owing to the low availability of polymorphic markers. In the present study, we developed a set of polymorphic intron-spanning markers(ISMs) using a cross-species mapping approach. In this approach, putative unique transcripts(PUTs) of L. culinaris were mapped onto the Medicago truncatula genome, exploiting its closeness with the lentil genome. Spliced alignment of the PUTs resulted in a total of 25,717 alignments, allowing the development of 1703 ISMs. From these, a subset of 105 ISMs were synthesized and validated with a 51% amplification success rate in 32 lentil genotypes. Of these ISMs, 40(74%) were polymorphic and generated 2–11 alleles per locus in a genetically diverse panel of 32 lentil genotypes including wild species.This set of polymorphic ISMs along with their functional annotation data will be useful in lentil breeding.
基金supported by the National Basic Research Program of China (973 Program) (No.2006CB943601)
文摘In the alternative splicing, intron retention, of histamine H3 receptors in rats and mice, the short transcript isoforms that are excised alternatively spliced introns are easily detected in a very low level in rats and are undetectable in mice using the regular PCR protocol. The retained introns have common 5' splice site and different 3' splice sites. The detailed mechanism for the special alternative splicing remains largely unclear. In this study, we developed a minigene splicing system to recapitulate natural alternative splicing of the receptors and investigated the effects of 5' and 3' splice sites on intron retention in HeLa cells. Mutating weak 5' and 3' splice sites of the alternatively spliced introns toward the canonical consensus sequences promoted the splicing of the corresponding introns in rat and mouse minigenes. The effect of splice site strength was context-dependent and much more sigiaificant for the 3' splice site of the longer alternative intron than for the 3' splice site of the shorter alternative intron and the common 5' splice sites; it was also more significant in the rat minigene than in the mouse minigene. Mutating the 3' splice site of the longer alternative intron resulted in almost complete splicing of the intron and made the corresponding isoform to become the nearly exclusive transcript in the rat minigene.
基金supported by the National Natural Science Foundation of China(30230620).
文摘Inter-reference of competitive reverse transcription polymerase chain reaction (RT-PCR)was constructed by intron method to detect the change of PC mRNA level in the pathway ofcarbohydrate metabolism. The experiment based on the principle that 81bp intron sequencewas deleted in PC mRNA compared with PC DNA sequence. The 466bp competitive DNA templaterecombinant plasmid of PC mRNA was successfully built by a pair of primer and was clonedonce, PC DNA and PC mRNA could be inter-referred each other. The intron approach used inthe experiment has broken through the traditional method of constructing competitivetemplate.
基金This work was financially supported by the National Natural Science Foundation of China(92249302,32370592)the National Key Research and Development Program of China(2023YFC3603300,2021YFA0909300).
文摘Intronic polyadenylation(IPA)is an RNA 3'end processing event which has been reported to play important roles in cancer development.However,the comprehensive landscape of IPA events across various cancer types is lacking.Here,we apply IPAFinder to identify and quantify IPA events in 10,383 samples covering all 33 cancer types from The Cancer Genome Atlas(TCGA)project.We identify a total of 21,835 IPA events,almost half of which are ubiquitously expressed.We identify 2761 unique dynamically changed IPA events across cancer types.Furthermore,we observe 8855 non-redundant clinically relevant IPA events,which could potentially be used as prognostic indicators.Our analysis also reveals that dynamic IPA usage within cancer signaling pathways may affect drug response.Finally,we develop a user-friendly data portal,IPACancer Atlas(http://www.tingni-lab.com/Pancan_IPA),to search and explore IPAs in cancer.