DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rear...DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.展开更多
The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to ...We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.展开更多
Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chro...Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.展开更多
In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal a...In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.展开更多
Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric ...Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.展开更多
A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was charact...A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work...The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.展开更多
The development of artificial supramolecular double-stranded helical structures has received widespread attention;however,the reports focusing on the construction and resolution of double-stranded helical assemblies b...The development of artificial supramolecular double-stranded helical structures has received widespread attention;however,the reports focusing on the construction and resolution of double-stranded helical assemblies based on terpyridine are relatively scarce.Herein,we report a series of extremely low-symmetry double-stranded helicates(S^(3),S^(4),and S^(R/S))based on the head-totail coordination mode of ladder-style ligands(L^(3),L^(4),and LR/S),which are apparently different from the conventional helicates with symmetrical axis.The ladder-style tridentate ligand L^(3)was first designed and synthesized by characteristic consecutive unsymmetrical modification of terpyridine.The chiral group 2,6-bis(oxazolinyl)pyridine(Py Box)was designed at the tail of tridentate ligand L^(3)and achieved the chiral resolution of the assembly.Moreover,the self-assembly of mixed three ladder-style ligands(didentate L2,tridentate L^(3),and tetradentate L^(4))and single terpyridine ligand(L^(1))with Zn(Ⅱ)also exhibited excellent narcissistic self-sorting behavior,without any statistical mixture.展开更多
Background Deoxyribonuclease 2(DNaseⅡ)plays a key role in clearing cytoplasmic double-stranded DNA(dsDNA).Deficiency of DNaseⅡleads to DNA accumulation in the cytoplasm.Persistent dsDNA in neurons is an early pathol...Background Deoxyribonuclease 2(DNaseⅡ)plays a key role in clearing cytoplasmic double-stranded DNA(dsDNA).Deficiency of DNaseⅡleads to DNA accumulation in the cytoplasm.Persistent dsDNA in neurons is an early pathological hallmark of senescence and neurodegenerative diseases including Alzheimer’s disease(AD).However,it is not clear how DNaseⅡand neuronal cytoplasmic dsDNA influence neuropathogenesis.Tau hyperphosphorylation is a key factor for the pathogenesis of AD.The effect of DNaseⅡand neuronal cytoplasmic dsDNA on neuronal tau hyperphosphorylation remains unclarified.Methods The levels of neuronal DNaseⅡand dsDNA in WT and Tau-P301S mice of different ages were measured by immunohistochemistry and immunolabeling,and the levels of DNaseⅡin the plasma of AD patients were measured by ELISA.To investigate the impact of DNaseⅡon tauopathy,the levels of phosphorylated tau,phosphokinase,phosphatase,synaptic proteins,gliosis and proinflammatory cytokines in the brains of neuronal DNaseⅡ-deficient WT mice,neuronal DNaseⅡ-deficient Tau-P301S mice and neuronal DNaseⅡ-overexpressing Tau-P301S mice were evaluated by immunolabeling,immunoblotting or ELISA.Cognitive performance was determined using the Morris water maze test,Y-maze test,novel object recognition test and open field test.Results The levels of DNaseⅡwere significantly decreased in the brains and the plasma of AD patients.DNaseⅡalso decreased age-dependently in the neurons of WT and Tau-P301S mice,along with increased dsDNA accumulation in the cytoplasm.The DNA accumulation induced by neuronal DNaseⅡdeficiency drove tau phosphorylation by upregulating cyclin-dependent-like kinase-5(CDK5)and calcium/calmodulin activated protein kinaseⅡ(CaMKⅡ)and downregulating phosphatase protein phosphatase 2A(PP2A).Moreover,DNaseⅡknockdown induced and significantly exacerbated neuron loss,neuroinflammation and cognitive deficits in WT and Tau-P301S mice,respectively,while overexpression of neuronal DNaseⅡexhibited therapeutic benefits.Conclusions DNaseⅡdeficiency and cytoplasmic dsDNA accumulation can initiate tau phosphorylation,suggesting DNaseⅡas a potential therapeutic target for tau-associated disorders.展开更多
The interaction of double-stranded （ds） and G-quadruplex （G4） DNA with sulfonyl 5-fluorouracil derivatives （5-fluoro-l-（arylsulfonyl） pyrimidine-2,4 （1H,3H）-diones） was investigated in this research, in whic...The interaction of double-stranded （ds） and G-quadruplex （G4） DNA with sulfonyl 5-fluorouracil derivatives （5-fluoro-l-（arylsulfonyl） pyrimidine-2,4 （1H,3H）-diones） was investigated in this research, in which Au electrodes modified with ds-DNA or G4-DNAs were used as a working electrode. The investigation showed that the binding affinity with G4-DNA was significantly increased when 5-fluorouracil （5-FU） was modified with arylsulfonyl groups. The presence of strong electron-withdrawing groups on benzene sulfonyl 5-FU greatly enhanced the binding selectivity （kG4-DNA/kds-DNA）. Such results provided new insights into the potential connections between the chemical structure of drug candidates and their anticancer activities.展开更多
The site-specific mutagenesis of the gene has become an important technique in gene modification and protein engineering. Among all methods, the primer extension one using single-stranded DNA (such as the infective fo...The site-specific mutagenesis of the gene has become an important technique in gene modification and protein engineering. Among all methods, the primer extension one using single-stranded DNA (such as the infective form of the M13 phage ) as template and the gapped stranded one are commonly used. But some genes, especially those展开更多
RNA interference(RNAi)has been used for agricultural insect pest control based on silencing of targeted insect genes.However,the effectiveness of RNAi and its applications in insect pest control remain challenging.Her...RNA interference(RNAi)has been used for agricultural insect pest control based on silencing of targeted insect genes.However,the effectiveness of RNAi and its applications in insect pest control remain challenging.Here we review factors that may affect the effectiveness of RNAi application,including the variability in RNAi efficacy among different insect species,a limited understanding of double-stranded RNA(dsRNA)uptake and systemic RNAi mechanisms,and the effective delivery of dsRNA in field conditions.Furthermore,we summarize recent progress in RNAi strategies for crop protection,discuss the advantages and disadvantages of RNAi-based insect control,and propose potential strategies to increase the effectiveness of RNAi in insect control.展开更多
Chromosomal DNA double-strand breaks(DSBs)are often generated in the genome of all living organisms.To combat DNA damage,organisms have evolved several DSB repair mechanisms,with nonhomologous end-joining(NHEJ)and hom...Chromosomal DNA double-strand breaks(DSBs)are often generated in the genome of all living organisms.To combat DNA damage,organisms have evolved several DSB repair mechanisms,with nonhomologous end-joining(NHEJ)and homologous recombination(HR)being the two most prominent.Although two major pathways have been extensively studied in Arabidopsis,rice and other mammals,the exact functions and differences between the two DSB repair pathways in maize still remain less well understood.Here,we characterized mre11a and rad50,mutants of HR pathway patterns,which showed drastic degradation of the typically persistent embryo and endosperm during kernel development.Loss of MRE11 or RAD50 function led to chromosomal fragments and chromosomal bridges in anaphase.While we also reported that the NHEJ pathway patterns,KU70 and KU80 are associated with developmental growth and genome stability.ku70 and ku80 both displayed an obvious dwarf phenotype.Cytological analysis of the mutants revealed extensive chromosome fragmentation in metaphase and subsequent stages.Loss of KU70/80 function upregulated the expression of genes involved in cell cycle progression and nuclear division.These results provide insights into how NHEJ and HR are mechanistically executed during different plant developmental periods and highlight a competitive and complementary relationship between the NHEJ and HR pathways for DNA double-strand break repair in maize.展开更多
DNA double-strand breaks(DSBs)may result in cellular mutations,apoptosis,and cell death,making them critical determinants of cellular survival and functionality,as well as major mechanisms underlying cell death.The su...DNA double-strand breaks(DSBs)may result in cellular mutations,apoptosis,and cell death,making them critical determinants of cellular survival and functionality,as well as major mechanisms underlying cell death.The success of nanodosimetry lies in the reduction in the number of modeling parameters to be adjusted for the model to predict experimental data on radiation biology.Based on this background,this study modified and simplified the logistic nanodosimetry model(LNDM)based on radiation-induced DSB probability.The probability distribution of ionization cluster size P(v|Q)under irradiation with carbon-ion beams was obtained through a track-structure Monte Carlo(MC)simulation,and then,the nanodosimetric quantities and DSB probability were calculated.Combining the assumptions of the linear quadratic(LQ)model and LNDM,DSB probability-based modification and simplification of the LNDM were conducted.Additionally,based on the radiobiological experimental data of human salivary gland(HSG),Chinese hamster lung(V79),and Chinese hamster ovary(CHO-K1)cells,the least-squares method was used to optimize the parameters of the modified LNDM(mLNDM).The mLNDM accurately reproduced the experimental data of HSG,V79,and CHO-K1 cells,and the results showed that the model parameters r and m_(0) were independent of the cell type,that is,the biological effects of cells with different radiosensitivities can be characterized by adjusting only the model parameters k and P_(s→l).Compared with HSG and CHO-K1 cells,V79 cells had smaller k and P_(s→l)values,indicating that that DSBs have a lower probability of eventually causing lethal damage,and sublethal events are less likely to interact to form lethal events,thereby having radioresistant characteristics.Compared with the LNDM,the mLNDM eliminates the tedious derivation process and connects the quantities characterizing radiation quality at the nanoscale level using radiation biological effects in a more direct and easy-to-understand manner,thus providing a simpler and more accurate method for calculating relative biological effectiveness for ion-beam treatment planning.展开更多
The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbe...The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbent assay (ELISA) was used to quantify γH2AX, a molecular marker for DSBs, in the blood of mice after a 6-hour exposure to magnetic resonance imaging (MRI). Fourteen CF-1 female mice were separated into 4 experimental groups: Untreated negative control, MRI-treated, MRI-Control, and exposed to ionizing radiation positive control. Untreated negative control was used as a baseline for ELISA to quantify γH2AX. MRI-treated consisted of a 6-hour continuous magnetic resonance imaging (MRI) echo planar imaging (EPI) sequence with a slew rate of 192 mT/m/s constituting a significantly longer imaging time than routine clinical imaging. MRI-control mice were maintained under the same conditions outside the MRI scanner for 6-hours. Mice in the irradiation group served as a positive control of DSBs and were exposed to either 2 Gy, 5 Gy or 10 Gy of ionizing radiation. DSBs in the blood lymphocytes from the treatment groups were analyzed using the γH2AX ELISA and compared. Total protein concentration in lysates was determined for each blood sample and averaged 1 ± 0.35 mg/mL. Irradiated positive controls were used to test radiation dose-dependency of the γH2AX ELISA assay where a linear dependency on radiation exposure was observed (r<sup>2</sup> = 0.93) between untreated and irradiated samples. Mean and standard error mean of γH2AX formation were calculated and compared between each treatment group. Repeated measures 1-way ANOVA showed statistically significant differences between the means of irradiated controls and both the MRI-control and MRI-treated groups. There was no statistically significant difference between the MRI-treated samples and the MRI-control groups. Our results show that long MRI exposure at a high slew rate did not cause increased levels of γH2AX when compared to control mice, suggesting that no increase in DSBs was caused by the long MR thermometry imaging session. The novelty of this work contradicts other studies that have suggested MRI may cause DSBs;this work suggests an alternative cause of DNA damage.展开更多
DNA is the hereditary material in humans and almost all other organisms. It is essential for maintaining accurate transmission of genetic information. In the life cycle, DNA replication, cell division, or genome damag...DNA is the hereditary material in humans and almost all other organisms. It is essential for maintaining accurate transmission of genetic information. In the life cycle, DNA replication, cell division, or genome damage, including that caused by endogenous and exogenous agents, may cause DNA aberrations. Of all forms of DNA damage, DNA double-strand breaks(DSBs) are the most serious. If the repair function is defective, DNA damage may cause gene mutation, genome instability, and cell chromosome loss, which in turn can even lead to tumorigenesis. DNA damage can be repaired through multiple mechanisms. Homologous recombination(HR) and non-homologous end joining(NHEJ) are the two main repair mechanisms for DNA DSBs. Increasing amounts of evidence reveal that protein modifications play an essential role in DNA damage repair.Protein deubiquitination is a vital post-translational modification which removes ubiquitin molecules or polyubiquitinated chains from substrates in order to reverse the ubiquitination reaction. This review discusses the role of deubiquitinating enzymes(DUBs) in repairing DNA DSBs. Exploring the molecular mechanisms of DUB regulation in DSB repair will provide new insights to combat human diseases and develop novel therapeutic approaches.展开更多
Maintenance of cellular homeostasis and genome integrity is a critical responsibility of DNA double-strand break(DSB)signaling.P53-binding protein 1(53BP1)plays a critical role in coordinating the DSB repair pathway c...Maintenance of cellular homeostasis and genome integrity is a critical responsibility of DNA double-strand break(DSB)signaling.P53-binding protein 1(53BP1)plays a critical role in coordinating the DSB repair pathway choice and promotes the non-homologous end-joining(NHEJ)-mediated DSB repair pathway that rejoins DSB ends.New insights have been gained into a basic molecular mechanism that is involved in 53BP1 recruitment to the DNA lesion and how 53BP1 then recruits the DNA break-responsive effectors that promote NHEJ-mediated DSB repair while inhibiting homologous recombination(HR)signaling.This review focuses on the up-and downstream pathways of 53BP1 and how 53BP1 promotes NHEJ-mediated DSB repair,which in turn promotes the sensitivity of poly(ADP-ribose)polymerase inhibitor(PARPi)in BRCA1-deficient cancers and consequently provides an avenue for improving cancer therapy strategies.展开更多
基金supported by the National Natural Science Foundation of China(Nos.31571511 and 31871500)
文摘DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
基金financially supported by the National Natural Science Foundation of China(Nos.21574054,21722403,and 21420102007)
文摘We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.
基金The authors thank Alexandra Surcel and Carey L Hendrix Lord for helpful comments on this manuscript.The work in our laboratory is supported by grants from the National Science Foundation(IBN-0077832,MCB-9896340,MCB-0092075)the National Institutes of Health(R0 1 GM63871)+3 种基金the US Department of Agriculture(2001-35301-10570 and 2003-35301-13313)Wuxing L was partially supported by the Intercollege Graduate Degree Program in Plant PhysiologyHong M gratefully acknowledges the support of the John Simon Guggenheim Foundationthe National Institutes of Health(F33 GM72245-1).
文摘Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
基金supported by the National Natural Science Foundation of China(11272193 and 10872121)the Shanghai Leading Academic Discipline Project(S30106)
文摘In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.
基金supported in part by the National Natural Science Foundation of China (Grant No. 11004082)the Natural Science Foundation of Guangdong Province of China (Grant No. 01005249)the Fundamental Research Funds for the Central Universities of China (Grant No. 21609305)
文摘Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.
基金Supported by the National Natural Science Foundation of China (61205184)the Department of Education of Zhejiang Province (Y201122207)+1 种基金Open Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (YR2012013)the Young Researchers Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (ZYG2012003)
文摘A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
基金Project supported by the National Natural Science Foundation of China (Grant No.11974366)the Fundamental Research Funds for the Central Universities+2 种基金Chinathe Supercomputer Center of the Chinese Academy of Sciencesthe Shanghai Supercomputer Center of China。
文摘The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.
基金supported by the Natural Science Foundation of Jilin Province(20230101027JC for M.Wang)the National Natural Science Foundation of China(22071079 for M.Wang)the Natural Science Foundation of Xinjiang Uygur Autonomous Region(2023D01C203 for J.Ma)。
文摘The development of artificial supramolecular double-stranded helical structures has received widespread attention;however,the reports focusing on the construction and resolution of double-stranded helical assemblies based on terpyridine are relatively scarce.Herein,we report a series of extremely low-symmetry double-stranded helicates(S^(3),S^(4),and S^(R/S))based on the head-totail coordination mode of ladder-style ligands(L^(3),L^(4),and LR/S),which are apparently different from the conventional helicates with symmetrical axis.The ladder-style tridentate ligand L^(3)was first designed and synthesized by characteristic consecutive unsymmetrical modification of terpyridine.The chiral group 2,6-bis(oxazolinyl)pyridine(Py Box)was designed at the tail of tridentate ligand L^(3)and achieved the chiral resolution of the assembly.Moreover,the self-assembly of mixed three ladder-style ligands(didentate L2,tridentate L^(3),and tetradentate L^(4))and single terpyridine ligand(L^(1))with Zn(Ⅱ)also exhibited excellent narcissistic self-sorting behavior,without any statistical mixture.
基金supported by funding from the Strategic Priority Research Program of the Chinese Academy of Sciences(XDB39050600)the National Natural Science Foundation of China(82150107 and 81971073)the National Key Research and Development Program of China(2020YFA0712402).
文摘Background Deoxyribonuclease 2(DNaseⅡ)plays a key role in clearing cytoplasmic double-stranded DNA(dsDNA).Deficiency of DNaseⅡleads to DNA accumulation in the cytoplasm.Persistent dsDNA in neurons is an early pathological hallmark of senescence and neurodegenerative diseases including Alzheimer’s disease(AD).However,it is not clear how DNaseⅡand neuronal cytoplasmic dsDNA influence neuropathogenesis.Tau hyperphosphorylation is a key factor for the pathogenesis of AD.The effect of DNaseⅡand neuronal cytoplasmic dsDNA on neuronal tau hyperphosphorylation remains unclarified.Methods The levels of neuronal DNaseⅡand dsDNA in WT and Tau-P301S mice of different ages were measured by immunohistochemistry and immunolabeling,and the levels of DNaseⅡin the plasma of AD patients were measured by ELISA.To investigate the impact of DNaseⅡon tauopathy,the levels of phosphorylated tau,phosphokinase,phosphatase,synaptic proteins,gliosis and proinflammatory cytokines in the brains of neuronal DNaseⅡ-deficient WT mice,neuronal DNaseⅡ-deficient Tau-P301S mice and neuronal DNaseⅡ-overexpressing Tau-P301S mice were evaluated by immunolabeling,immunoblotting or ELISA.Cognitive performance was determined using the Morris water maze test,Y-maze test,novel object recognition test and open field test.Results The levels of DNaseⅡwere significantly decreased in the brains and the plasma of AD patients.DNaseⅡalso decreased age-dependently in the neurons of WT and Tau-P301S mice,along with increased dsDNA accumulation in the cytoplasm.The DNA accumulation induced by neuronal DNaseⅡdeficiency drove tau phosphorylation by upregulating cyclin-dependent-like kinase-5(CDK5)and calcium/calmodulin activated protein kinaseⅡ(CaMKⅡ)and downregulating phosphatase protein phosphatase 2A(PP2A).Moreover,DNaseⅡknockdown induced and significantly exacerbated neuron loss,neuroinflammation and cognitive deficits in WT and Tau-P301S mice,respectively,while overexpression of neuronal DNaseⅡexhibited therapeutic benefits.Conclusions DNaseⅡdeficiency and cytoplasmic dsDNA accumulation can initiate tau phosphorylation,suggesting DNaseⅡas a potential therapeutic target for tau-associated disorders.
基金supported by the National Natural Science Foundation of China (21073133,20843007)Zhejiang Provincial Natural Science Foundation of China (Y4080177,Y4090248,Y5100283)Zhejiang Provincial Ministry of Education (Y200907715)
文摘The interaction of double-stranded （ds） and G-quadruplex （G4） DNA with sulfonyl 5-fluorouracil derivatives （5-fluoro-l-（arylsulfonyl） pyrimidine-2,4 （1H,3H）-diones） was investigated in this research, in which Au electrodes modified with ds-DNA or G4-DNAs were used as a working electrode. The investigation showed that the binding affinity with G4-DNA was significantly increased when 5-fluorouracil （5-FU） was modified with arylsulfonyl groups. The presence of strong electron-withdrawing groups on benzene sulfonyl 5-FU greatly enhanced the binding selectivity （kG4-DNA/kds-DNA）. Such results provided new insights into the potential connections between the chemical structure of drug candidates and their anticancer activities.
基金Project supported by the National High Technology Foundation (Term No. 103-20).
文摘The site-specific mutagenesis of the gene has become an important technique in gene modification and protein engineering. Among all methods, the primer extension one using single-stranded DNA (such as the infective form of the M13 phage ) as template and the gapped stranded one are commonly used. But some genes, especially those
基金funded by the National Natural Science Foundation of China(32188102 to Lanqin Xia)Natural Science Foundation for Distinguished Young Scholars of Jiangxi province(20212ACB215001 to Xiudao Yu)+1 种基金supported by the China Scholarship Council(202303250062)the GSCAAS-ULg Joint PhD Program。
文摘RNA interference(RNAi)has been used for agricultural insect pest control based on silencing of targeted insect genes.However,the effectiveness of RNAi and its applications in insect pest control remain challenging.Here we review factors that may affect the effectiveness of RNAi application,including the variability in RNAi efficacy among different insect species,a limited understanding of double-stranded RNA(dsRNA)uptake and systemic RNAi mechanisms,and the effective delivery of dsRNA in field conditions.Furthermore,we summarize recent progress in RNAi strategies for crop protection,discuss the advantages and disadvantages of RNAi-based insect control,and propose potential strategies to increase the effectiveness of RNAi in insect control.
基金supported by the National Natural Science Foundation of China(32372116)to Yan He.
文摘Chromosomal DNA double-strand breaks(DSBs)are often generated in the genome of all living organisms.To combat DNA damage,organisms have evolved several DSB repair mechanisms,with nonhomologous end-joining(NHEJ)and homologous recombination(HR)being the two most prominent.Although two major pathways have been extensively studied in Arabidopsis,rice and other mammals,the exact functions and differences between the two DSB repair pathways in maize still remain less well understood.Here,we characterized mre11a and rad50,mutants of HR pathway patterns,which showed drastic degradation of the typically persistent embryo and endosperm during kernel development.Loss of MRE11 or RAD50 function led to chromosomal fragments and chromosomal bridges in anaphase.While we also reported that the NHEJ pathway patterns,KU70 and KU80 are associated with developmental growth and genome stability.ku70 and ku80 both displayed an obvious dwarf phenotype.Cytological analysis of the mutants revealed extensive chromosome fragmentation in metaphase and subsequent stages.Loss of KU70/80 function upregulated the expression of genes involved in cell cycle progression and nuclear division.These results provide insights into how NHEJ and HR are mechanistically executed during different plant developmental periods and highlight a competitive and complementary relationship between the NHEJ and HR pathways for DNA double-strand break repair in maize.
基金supported by the National Key Research and Development Program of China(No.2022YFC2401503)Key Research and Development Program of Gansu Province(No.23YFFA0010)+1 种基金Natural Science Foundation of Gansu Province(No.23JRRA625)Special Project of Science and Technology Cooperation between Hubei Province and Chinese Academy of Sciences(No.42000021817T300000050)。
文摘DNA double-strand breaks(DSBs)may result in cellular mutations,apoptosis,and cell death,making them critical determinants of cellular survival and functionality,as well as major mechanisms underlying cell death.The success of nanodosimetry lies in the reduction in the number of modeling parameters to be adjusted for the model to predict experimental data on radiation biology.Based on this background,this study modified and simplified the logistic nanodosimetry model(LNDM)based on radiation-induced DSB probability.The probability distribution of ionization cluster size P(v|Q)under irradiation with carbon-ion beams was obtained through a track-structure Monte Carlo(MC)simulation,and then,the nanodosimetric quantities and DSB probability were calculated.Combining the assumptions of the linear quadratic(LQ)model and LNDM,DSB probability-based modification and simplification of the LNDM were conducted.Additionally,based on the radiobiological experimental data of human salivary gland(HSG),Chinese hamster lung(V79),and Chinese hamster ovary(CHO-K1)cells,the least-squares method was used to optimize the parameters of the modified LNDM(mLNDM).The mLNDM accurately reproduced the experimental data of HSG,V79,and CHO-K1 cells,and the results showed that the model parameters r and m_(0) were independent of the cell type,that is,the biological effects of cells with different radiosensitivities can be characterized by adjusting only the model parameters k and P_(s→l).Compared with HSG and CHO-K1 cells,V79 cells had smaller k and P_(s→l)values,indicating that that DSBs have a lower probability of eventually causing lethal damage,and sublethal events are less likely to interact to form lethal events,thereby having radioresistant characteristics.Compared with the LNDM,the mLNDM eliminates the tedious derivation process and connects the quantities characterizing radiation quality at the nanoscale level using radiation biological effects in a more direct and easy-to-understand manner,thus providing a simpler and more accurate method for calculating relative biological effectiveness for ion-beam treatment planning.
文摘The purpose of the study was to investigate if the high gradient strength and slew rate used for long MRI-thermometry monitoring could cause DNA double-stranded breaks (DSBs). To this end, an enzyme-linked immunosorbent assay (ELISA) was used to quantify γH2AX, a molecular marker for DSBs, in the blood of mice after a 6-hour exposure to magnetic resonance imaging (MRI). Fourteen CF-1 female mice were separated into 4 experimental groups: Untreated negative control, MRI-treated, MRI-Control, and exposed to ionizing radiation positive control. Untreated negative control was used as a baseline for ELISA to quantify γH2AX. MRI-treated consisted of a 6-hour continuous magnetic resonance imaging (MRI) echo planar imaging (EPI) sequence with a slew rate of 192 mT/m/s constituting a significantly longer imaging time than routine clinical imaging. MRI-control mice were maintained under the same conditions outside the MRI scanner for 6-hours. Mice in the irradiation group served as a positive control of DSBs and were exposed to either 2 Gy, 5 Gy or 10 Gy of ionizing radiation. DSBs in the blood lymphocytes from the treatment groups were analyzed using the γH2AX ELISA and compared. Total protein concentration in lysates was determined for each blood sample and averaged 1 ± 0.35 mg/mL. Irradiated positive controls were used to test radiation dose-dependency of the γH2AX ELISA assay where a linear dependency on radiation exposure was observed (r<sup>2</sup> = 0.93) between untreated and irradiated samples. Mean and standard error mean of γH2AX formation were calculated and compared between each treatment group. Repeated measures 1-way ANOVA showed statistically significant differences between the means of irradiated controls and both the MRI-control and MRI-treated groups. There was no statistically significant difference between the MRI-treated samples and the MRI-control groups. Our results show that long MRI exposure at a high slew rate did not cause increased levels of γH2AX when compared to control mice, suggesting that no increase in DSBs was caused by the long MR thermometry imaging session. The novelty of this work contradicts other studies that have suggested MRI may cause DSBs;this work suggests an alternative cause of DNA damage.
基金supported by the National Natural Science Foundation of China (Nos. 91749115 and 81872298)the Natural Science Foundation of Jiangxi Province (No. 20181BAB205044), China。
文摘DNA is the hereditary material in humans and almost all other organisms. It is essential for maintaining accurate transmission of genetic information. In the life cycle, DNA replication, cell division, or genome damage, including that caused by endogenous and exogenous agents, may cause DNA aberrations. Of all forms of DNA damage, DNA double-strand breaks(DSBs) are the most serious. If the repair function is defective, DNA damage may cause gene mutation, genome instability, and cell chromosome loss, which in turn can even lead to tumorigenesis. DNA damage can be repaired through multiple mechanisms. Homologous recombination(HR) and non-homologous end joining(NHEJ) are the two main repair mechanisms for DNA DSBs. Increasing amounts of evidence reveal that protein modifications play an essential role in DNA damage repair.Protein deubiquitination is a vital post-translational modification which removes ubiquitin molecules or polyubiquitinated chains from substrates in order to reverse the ubiquitination reaction. This review discusses the role of deubiquitinating enzymes(DUBs) in repairing DNA DSBs. Exploring the molecular mechanisms of DUB regulation in DSB repair will provide new insights to combat human diseases and develop novel therapeutic approaches.
文摘Maintenance of cellular homeostasis and genome integrity is a critical responsibility of DNA double-strand break(DSB)signaling.P53-binding protein 1(53BP1)plays a critical role in coordinating the DSB repair pathway choice and promotes the non-homologous end-joining(NHEJ)-mediated DSB repair pathway that rejoins DSB ends.New insights have been gained into a basic molecular mechanism that is involved in 53BP1 recruitment to the DNA lesion and how 53BP1 then recruits the DNA break-responsive effectors that promote NHEJ-mediated DSB repair while inhibiting homologous recombination(HR)signaling.This review focuses on the up-and downstream pathways of 53BP1 and how 53BP1 promotes NHEJ-mediated DSB repair,which in turn promotes the sensitivity of poly(ADP-ribose)polymerase inhibitor(PARPi)in BRCA1-deficient cancers and consequently provides an avenue for improving cancer therapy strategies.
