Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric ...Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.展开更多
The China-ASEAN Free Trade Area(CAFTA)3.0Upgrade Protocol added a section on“Supply Chain Connectivity,”which emphasizes that all parties recognize the lessons learned from the COVID-19 pandemic and cooperate to enh...The China-ASEAN Free Trade Area(CAFTA)3.0Upgrade Protocol added a section on“Supply Chain Connectivity,”which emphasizes that all parties recognize the lessons learned from the COVID-19 pandemic and cooperate to enhance the resilience of the regional supply chain.This is an inevitable trend amid the current accelerated restructuring of the global supply chain,the complex and severe international economic and trade situation,and the impact on the regional industrial chain.It also represents a fundamental shift and consensus on the logic of supply chain cooperation between China and ASEAN countries—a transformation from“Efficiency First”to“Resilience First.”展开更多
Short-chain fatty acids,metabolites produced by the fermentation of dietary fiber by gut microbiota,have garnered significant attention due to their correlation with neurodegenerative diseases,particularly Parkinson’...Short-chain fatty acids,metabolites produced by the fermentation of dietary fiber by gut microbiota,have garnered significant attention due to their correlation with neurodegenerative diseases,particularly Parkinson’s disease.In this review,we summarize the changes in short-chain fatty acid levels and the abundance of short-chain fatty acid-producing bacteria in various samples from patients with Parkinson’s disease,highlighting the critical role of gut homeostasis imbalance in the pathogenesis and progression of the disease.Focusing on the nervous system,we discuss the molecular mechanisms by which short-chain fatty acids influence the homeostasis of both the enteric nervous system and the central nervous system.We identify key processes,including the activation of G protein-coupled receptors and the inhibition of histone deacetylases by short-chain fatty acids.Importantly,structural or functional disruptions in the enteric nervous system mediated by these fatty acids may lead to abnormalα-synuclein expression and gastrointestinal dysmotility,which could serve as an initiating event in Parkinson’s disease.Furthermore,we propose that short-chain fatty acids help establish communication between the enteric nervous system and the central nervous system via the vagal nerve,immune circulation,and endocrine signaling.This communication may shed light on their potential role in the transmission ofα-synuclein from the gut to the brain.Finally,we elucidate novel treatment strategies for Parkinson’s disease that target short-chain fatty acids and examine the challenges associated with translating short-chain fatty acid-based therapies into clinical practice.In conclusion,this review emphasizes the pivotal role of short-chain fatty acids in regulating gut-brain axis integrity and their significance in the pathogenesis of Parkinson’s disease from the perspective of the nervous system.Moreover,it highlights the potential value of short-chain fatty acids in early intervention for Parkinson’s disease.Future research into the molecular mechanisms of short-chain fatty acids and their synergistic interactions with other gut metabolites is likely to advance the clinical translation of innovative short-chain fatty acid-based therapies for Parkinson’s disease.展开更多
Despite demonstrating significant anti-tumor potential as an artemisinin derivative,artesunate faces delivery efficiency challenges due to low water solubility and insufficient targeting specificity.To improve the del...Despite demonstrating significant anti-tumor potential as an artemisinin derivative,artesunate faces delivery efficiency challenges due to low water solubility and insufficient targeting specificity.To improve the delivery efficiency,we engineered three artesunate(ART) derivatives,AC_(15)-L(linear),AC_(15)-B(branched),and AC_(15)-C(cyclic) with distinct aliphatic chain architectures.Unexpectedly,we observed that AC_(15)-C exhibited superior cytotoxicity against 4T1 breast cancer cells,and had the highest binding affinity for Lon protease 1(LONP1)(-72.6 kcal/mol).Subsequently,disulfide bond-containing lipid-PEG(DSPESS-PEG2K) modified chain architecture-engineered ART derivatives nanoassemblies(NAs) were developed to mitigate solubility-related limitations while enhancing targeting precision.Molecular docking and experimental validation demonstrated that ART derivatives inhibited LONP1 through hydrophobic interactions while preserved Fe^(2+)-mediated Fenton-like reaction activity.In vitro and in vivo evaluations demonstrated that AC_(15)-C NAs outperformed free ART and other NAs,suppressing 4T1 tumor growth via dual action:LONP1-directed mitochondrial proteostasis collapse and reactive oxygen species(ROS) amplification through Fe^(2+)-ART interactions.This study elucidated a novel anti-tumor mechanism of ART through the rational design of derivatives with spatially configured aliphatic chains,and developed reductionresponsive NAs to provide an advanced delivery strategy.展开更多
Against a backdrop of rising global trade protectionism and accelerated restructuring of international industrial and supply chains,regional institutional cooperation is becoming a key force in stabilizing cross-borde...Against a backdrop of rising global trade protectionism and accelerated restructuring of international industrial and supply chains,regional institutional cooperation is becoming a key force in stabilizing cross-border trade and investment.The ASEAN region enjoys strong economic growth momentum with a distinct demographic advantage while China boasts a complete industrial system and manufacturing capacity.展开更多
On December 18,2023,a magnitude 6.2 earthquake struck Jishishan County,Gansu Province,triggering a liquefaction-induced flow slide along the loess-mudstone contact zone and causing significant casualties and property ...On December 18,2023,a magnitude 6.2 earthquake struck Jishishan County,Gansu Province,triggering a liquefaction-induced flow slide along the loess-mudstone contact zone and causing significant casualties and property losses.The event featured low-slope,large-scale,runout distance sliding and exhibited a clear cascading disaster chain.Its characteristics closely resemble the catastrophic mudflow at the nearby Lajia Ruins approximately 4,000 years ago.Using high-resolution oblique photogrammetry,cone penetration testing,surface wave analysis,and horizontal-to-vertical spectral ratio methods,this study examines the stratigraphy,groundwater conditions,and geomechanical properties of the affected zone.Results indicate that saturated loess overlying impermeable mudstone formed a high-moisture mass vulnerable to seismic disturbance.Seismic resonance triggered the liquefaction of weakly structured loess,which slide along the contact interface and evolved into a runout distance mudflow.Underground water and terrain modification created a composite weak zone of saturated loess and softened mudstone,which intensified the disaster chain-from earthquake to liquefaction,flow slide,and mudflow.This study contributes to the understanding of deep-seated liquefaction-flow slide disasters,thereby advancing more effective risk mitigation strategies in the Loess Plateau and comparable loess-covered seismic regions.展开更多
Dirac nodal line semimetals with topologically protected drumhead surface states have attracted intense theoretical and experimental attention over a decade.However,the study of type-ⅡDirac nodal line semimetals is r...Dirac nodal line semimetals with topologically protected drumhead surface states have attracted intense theoretical and experimental attention over a decade.However,the study of type-ⅡDirac nodal line semimetals is rare,especially the type-Ⅱnodal chain semimetals have not been confirmed by experiment due to the lack of ideal material platform.In this study,based on symmetry analysis and the first-principles electronic structure calculations,we predict that CrB_(4) is an ideal type-ⅡDirac nodal chain semimetal protected by the mirror symmetry.Moreover,there are two nodal rings protected by both space-inversion and time-reversal symmetries in CrB_(4).More importantly,in CrB_(4) the topologically protected drumhead surface states span the entire Brillouin zone at the Fermi level.Considering the fact that CrB_(4) has been synthesized experimentally and the spin-orbit coupling is very weak,CrB_(4) provides an ideal material platform for studying the exotic properties of type-ⅡDirac nodal chain semimetals in experiment.展开更多
Tellurene,a chiral chain semiconductor with a narrow bandgap and exceptional strain sensitivity,emerges as a pivotal material for tailoring electronic and optoelectronic properties via strain engineering.This study el...Tellurene,a chiral chain semiconductor with a narrow bandgap and exceptional strain sensitivity,emerges as a pivotal material for tailoring electronic and optoelectronic properties via strain engineering.This study elucidates the fundamental mechanisms of ultrafast laser shock imprinting(LSI)in two-dimensional tellurium(Te),establishing a direct relationship between strain field orientation,mold topology,and anisotropic structural evolution.This is the first demonstration of ultrafast LSI on chiral chain Te unveiling orientation-sensitive dislocation networks.By applying controlled strain fields parallel or transverse to Te’s helical chains,we uncover two distinct deformation regimes.Strain aligned parallel to the chain’s direction induces gliding and rotation governed by weak interchain interactions,preserving covalent intrachain bonds and vibrational modes.In contrast,transverse strain drives shear-mediated multimodal deformations—tensile stretching,compression,and bending—resulting in significant lattice distortions and electronic property modulation.We discovered the critical role of mold topology on deformation:sharp-edged gratings generate localized shear forces surpassing those from homogeneous strain fields via smooth CD molds,triggering dislocation tangle formation,lattice reorientation,and inhomogeneous plastic deformation.Asymmetrical strain configurations enable localized structural transformations while retaining single-crystal integrity in adjacent regions—a balance essential for functional device integration.These insights position LSI as a precision tool for nanoscale strain engineering,capable of sculpting 2D material morphologies without compromising crystallinity.By bridging ultrafast mechanics with chiral chain material science,this work advances the design of strain-tunable devices for next-generation electronics and optoelectronics,while establishing a universal framework for manipulating anisotropic 2D systems under extreme strain rates.This work discovered crystallographic orientation-dependent deformation mechanisms in 2D Te,linking parallel strain to chain gliding and transverse strain to shear-driven multimodal distortion.It demonstrates mold geometry as a critical lever for strain localization and dislocation dynamics,with sharp-edged gratings enabling unprecedented control over lattice reorientation.Crucially,the identification of strain field conditions that reconcile severe plastic deformation with single-crystal retention offers a pathway to functional nanostructure fabrication,redefining LSI’s potential in ultrafast strain engineering of chiral chain materials.展开更多
The shift toward specialized and large-scale agricultural production has spurred the emergence of agricultural clusters as key forces of rural vitalization and sustainable development.This paper explored the formation...The shift toward specialized and large-scale agricultural production has spurred the emergence of agricultural clusters as key forces of rural vitalization and sustainable development.This paper explored the formation and evolution of Meizhou pomelo industry cluster in China,focusing on its role in restructuring rural socio-economic systems and integrating the whole value chains.Based on a case study employing qualitative methods such as in-depth interviews and participatory observation,the agricultural cluster evolution of Meizhou pomelo was categorized into three key phases of initial decentralization,self-organized scaling,and reorganized clustering.Geographical proximity and industrial agglomeration constitute the physical foundation,while vertical/horizontal linkages,technologic-al innovation,and policy support enhance competitiveness.Special mechanisms emerge through localized social networks,farmer co-operatives’activation,and cross-regional market expansion.The cluster’s impact is manifested in the shift from extensive to standard-ized and modernized production,diversified and flexible livelihood of farmers,and the integration of agriculture with industry and ser-vices.The development of the whole value chain based on agricultural cluster represents a critical pathway for achieving agricultural modernization,encompassing both internal and external value chain optimization.Through quality assurance systems,product diversi-fication strategies,operational efficiency improvements,and brand enhancement,these clusters amplify product value propositions and market competitiveness.This systemic approach facilitates supply-demand coordination,enables resource synergies,and optimizes eco-nomic returns across the horizontal and vertical value chain.This paper argues that agricultural clusters serve as strategic catalysts for sustainable rural development by reconstructing local production systems,fostering innovation ecosystems,and aligning agricultural modernization.It contributes to debates on rural vitalization by demonstrating how agricultural clustering can reconfigure rural areas as hubs of ecological modernization,rather than mere urban peripheries.展开更多
Post-exercise whey protein isolate(WPI)supplement is beneficial for skeletal muscle recovery due to the stimulation of branched chain amino acids(BCAAs).This implies us that intake slow digestion rate of protein to su...Post-exercise whey protein isolate(WPI)supplement is beneficial for skeletal muscle recovery due to the stimulation of branched chain amino acids(BCAAs).This implies us that intake slow digestion rate of protein to sustain BCAAs releasing rate may facilitate muscle protein synthesis.To examine this hypothesis,we conducted a series of protein supplements including modified slow-digesting whey(SDW),whey,hydrolyzed whey and casein,orally to mice undergoing endurance running.Our results showed that the SDW gavage constant supplied BCAAs in the serum of mice within 6 h and significantly enhanced(P<0.01)endurance exercise capacity,compared to other groups.In addition,the SDW supplementation increased the crosssectional area of mice gastrocnemius fibers,as well as their muscle and liver glycogen content.It also increased the testosterone/cortisol ratio in serum and interleukin-6(IL-6)levels in muscle,while it decreased the tumor necrosis factor-alpha(TNF-α)levels and oxidative stress in muscle.Moreover,it may activate mechanistic target of rapamycin signaling by upregulating mRNA(bcat-1 and pgc-1α)expression.Thus,our findings illustrate that prolonged BCAAs supply duration promotes mice endurance running capacity and skeletal muscle growth,contributing to the advancement of sports nutrition practices.展开更多
The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the prese...The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.展开更多
DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rear...DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.展开更多
We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to ...We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.展开更多
In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondri...In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.展开更多
Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chro...Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.展开更多
In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal a...In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.展开更多
The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work...The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.展开更多
A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was charact...A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.展开更多
Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA...Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.展开更多
The concept of Supply Chain 4.0 represents a transformative phase in supply chain management through advanced digital technologies like IoT, AI, blockchain, and cyber-physical systems. While these innovations deliver ...The concept of Supply Chain 4.0 represents a transformative phase in supply chain management through advanced digital technologies like IoT, AI, blockchain, and cyber-physical systems. While these innovations deliver operational improvements, the heightened interconnectivity introduces significant cybersecurity challenges, particularly within military logistics, where mission-critical operations and life-safety concerns are paramount. This paper examines these unique cybersecurity requirements, focusing on advanced persistent threats, supply chain poisoning, and data breaches that could compromise sensitive operations. The study proposes a hybrid cybersecurity framework tailored to military logistics, integrating resilience, redundancy, and cross-jurisdictional security measures. Real-world applicability is validated through simulations, offering strategies for securing supply chains while balancing security, efficiency, and flexibility.展开更多
基金supported in part by the National Natural Science Foundation of China (Grant No. 11004082)the Natural Science Foundation of Guangdong Province of China (Grant No. 01005249)the Fundamental Research Funds for the Central Universities of China (Grant No. 21609305)
文摘Using nonequilibrium molecular dynamics simulations, we study the thermal conductivity of asymmetric double chains. We couple two different single chains through interchain coupling to build three kinds of asymmetric double- stranded chain system： intrachain interaction, external potential, and mass asymmetric double chains. It is reported that asymmetry is helpful in improving the thermal conductivity of the system. We first propose double-heat flux channels to explain the influence of asymmetric structures on the thermal conductivity. The phonon spectral behaviour and finite size effect are also included.
文摘The China-ASEAN Free Trade Area(CAFTA)3.0Upgrade Protocol added a section on“Supply Chain Connectivity,”which emphasizes that all parties recognize the lessons learned from the COVID-19 pandemic and cooperate to enhance the resilience of the regional supply chain.This is an inevitable trend amid the current accelerated restructuring of the global supply chain,the complex and severe international economic and trade situation,and the impact on the regional industrial chain.It also represents a fundamental shift and consensus on the logic of supply chain cooperation between China and ASEAN countries—a transformation from“Efficiency First”to“Resilience First.”
基金supported by the National Key R&D Program of China,No.2021YFC2501200(to PC).
文摘Short-chain fatty acids,metabolites produced by the fermentation of dietary fiber by gut microbiota,have garnered significant attention due to their correlation with neurodegenerative diseases,particularly Parkinson’s disease.In this review,we summarize the changes in short-chain fatty acid levels and the abundance of short-chain fatty acid-producing bacteria in various samples from patients with Parkinson’s disease,highlighting the critical role of gut homeostasis imbalance in the pathogenesis and progression of the disease.Focusing on the nervous system,we discuss the molecular mechanisms by which short-chain fatty acids influence the homeostasis of both the enteric nervous system and the central nervous system.We identify key processes,including the activation of G protein-coupled receptors and the inhibition of histone deacetylases by short-chain fatty acids.Importantly,structural or functional disruptions in the enteric nervous system mediated by these fatty acids may lead to abnormalα-synuclein expression and gastrointestinal dysmotility,which could serve as an initiating event in Parkinson’s disease.Furthermore,we propose that short-chain fatty acids help establish communication between the enteric nervous system and the central nervous system via the vagal nerve,immune circulation,and endocrine signaling.This communication may shed light on their potential role in the transmission ofα-synuclein from the gut to the brain.Finally,we elucidate novel treatment strategies for Parkinson’s disease that target short-chain fatty acids and examine the challenges associated with translating short-chain fatty acid-based therapies into clinical practice.In conclusion,this review emphasizes the pivotal role of short-chain fatty acids in regulating gut-brain axis integrity and their significance in the pathogenesis of Parkinson’s disease from the perspective of the nervous system.Moreover,it highlights the potential value of short-chain fatty acids in early intervention for Parkinson’s disease.Future research into the molecular mechanisms of short-chain fatty acids and their synergistic interactions with other gut metabolites is likely to advance the clinical translation of innovative short-chain fatty acid-based therapies for Parkinson’s disease.
基金financially supported by the Liaoning Revitalization Talents Program (No.XLYC2403107)the Excellent Youth Science Foundation of Liaoning Province (No.2024JH3/10200046)the Basic Scientific Research Project of Liaoning Provincial Department of Education (No.LJ212410163015)。
文摘Despite demonstrating significant anti-tumor potential as an artemisinin derivative,artesunate faces delivery efficiency challenges due to low water solubility and insufficient targeting specificity.To improve the delivery efficiency,we engineered three artesunate(ART) derivatives,AC_(15)-L(linear),AC_(15)-B(branched),and AC_(15)-C(cyclic) with distinct aliphatic chain architectures.Unexpectedly,we observed that AC_(15)-C exhibited superior cytotoxicity against 4T1 breast cancer cells,and had the highest binding affinity for Lon protease 1(LONP1)(-72.6 kcal/mol).Subsequently,disulfide bond-containing lipid-PEG(DSPESS-PEG2K) modified chain architecture-engineered ART derivatives nanoassemblies(NAs) were developed to mitigate solubility-related limitations while enhancing targeting precision.Molecular docking and experimental validation demonstrated that ART derivatives inhibited LONP1 through hydrophobic interactions while preserved Fe^(2+)-mediated Fenton-like reaction activity.In vitro and in vivo evaluations demonstrated that AC_(15)-C NAs outperformed free ART and other NAs,suppressing 4T1 tumor growth via dual action:LONP1-directed mitochondrial proteostasis collapse and reactive oxygen species(ROS) amplification through Fe^(2+)-ART interactions.This study elucidated a novel anti-tumor mechanism of ART through the rational design of derivatives with spatially configured aliphatic chains,and developed reductionresponsive NAs to provide an advanced delivery strategy.
文摘Against a backdrop of rising global trade protectionism and accelerated restructuring of international industrial and supply chains,regional institutional cooperation is becoming a key force in stabilizing cross-border trade and investment.The ASEAN region enjoys strong economic growth momentum with a distinct demographic advantage while China boasts a complete industrial system and manufacturing capacity.
基金National Natural Science Foundation of China Grant Nos.52378543,52378544 and 52408525the Natural Science Foundation of Heilongjiang Grant No.LH2024E119。
文摘On December 18,2023,a magnitude 6.2 earthquake struck Jishishan County,Gansu Province,triggering a liquefaction-induced flow slide along the loess-mudstone contact zone and causing significant casualties and property losses.The event featured low-slope,large-scale,runout distance sliding and exhibited a clear cascading disaster chain.Its characteristics closely resemble the catastrophic mudflow at the nearby Lajia Ruins approximately 4,000 years ago.Using high-resolution oblique photogrammetry,cone penetration testing,surface wave analysis,and horizontal-to-vertical spectral ratio methods,this study examines the stratigraphy,groundwater conditions,and geomechanical properties of the affected zone.Results indicate that saturated loess overlying impermeable mudstone formed a high-moisture mass vulnerable to seismic disturbance.Seismic resonance triggered the liquefaction of weakly structured loess,which slide along the contact interface and evolved into a runout distance mudflow.Underground water and terrain modification created a composite weak zone of saturated loess and softened mudstone,which intensified the disaster chain-from earthquake to liquefaction,flow slide,and mudflow.This study contributes to the understanding of deep-seated liquefaction-flow slide disasters,thereby advancing more effective risk mitigation strategies in the Loess Plateau and comparable loess-covered seismic regions.
基金supported by the National Natural Science Foundation of China(Grant Nos.11934020,12204533,62476278,and 62206299)the Fundamental Research Funds for the Central Universities+1 种基金the Research Funds of Renmin University of China(Grant No.24XNKJ15)the Innovation Program for Quantum Science and Technology(Grant No.2021ZD0302402)。
文摘Dirac nodal line semimetals with topologically protected drumhead surface states have attracted intense theoretical and experimental attention over a decade.However,the study of type-ⅡDirac nodal line semimetals is rare,especially the type-Ⅱnodal chain semimetals have not been confirmed by experiment due to the lack of ideal material platform.In this study,based on symmetry analysis and the first-principles electronic structure calculations,we predict that CrB_(4) is an ideal type-ⅡDirac nodal chain semimetal protected by the mirror symmetry.Moreover,there are two nodal rings protected by both space-inversion and time-reversal symmetries in CrB_(4).More importantly,in CrB_(4) the topologically protected drumhead surface states span the entire Brillouin zone at the Fermi level.Considering the fact that CrB_(4) has been synthesized experimentally and the spin-orbit coupling is very weak,CrB_(4) provides an ideal material platform for studying the exotic properties of type-ⅡDirac nodal chain semimetals in experiment.
基金financial support from NSF ExpandQISE program.The synthesis of tellurene was supported by NSF under grant no.CMMI-2046936supports from Purdue Research Foundation.
文摘Tellurene,a chiral chain semiconductor with a narrow bandgap and exceptional strain sensitivity,emerges as a pivotal material for tailoring electronic and optoelectronic properties via strain engineering.This study elucidates the fundamental mechanisms of ultrafast laser shock imprinting(LSI)in two-dimensional tellurium(Te),establishing a direct relationship between strain field orientation,mold topology,and anisotropic structural evolution.This is the first demonstration of ultrafast LSI on chiral chain Te unveiling orientation-sensitive dislocation networks.By applying controlled strain fields parallel or transverse to Te’s helical chains,we uncover two distinct deformation regimes.Strain aligned parallel to the chain’s direction induces gliding and rotation governed by weak interchain interactions,preserving covalent intrachain bonds and vibrational modes.In contrast,transverse strain drives shear-mediated multimodal deformations—tensile stretching,compression,and bending—resulting in significant lattice distortions and electronic property modulation.We discovered the critical role of mold topology on deformation:sharp-edged gratings generate localized shear forces surpassing those from homogeneous strain fields via smooth CD molds,triggering dislocation tangle formation,lattice reorientation,and inhomogeneous plastic deformation.Asymmetrical strain configurations enable localized structural transformations while retaining single-crystal integrity in adjacent regions—a balance essential for functional device integration.These insights position LSI as a precision tool for nanoscale strain engineering,capable of sculpting 2D material morphologies without compromising crystallinity.By bridging ultrafast mechanics with chiral chain material science,this work advances the design of strain-tunable devices for next-generation electronics and optoelectronics,while establishing a universal framework for manipulating anisotropic 2D systems under extreme strain rates.This work discovered crystallographic orientation-dependent deformation mechanisms in 2D Te,linking parallel strain to chain gliding and transverse strain to shear-driven multimodal distortion.It demonstrates mold geometry as a critical lever for strain localization and dislocation dynamics,with sharp-edged gratings enabling unprecedented control over lattice reorientation.Crucially,the identification of strain field conditions that reconcile severe plastic deformation with single-crystal retention offers a pathway to functional nanostructure fabrication,redefining LSI’s potential in ultrafast strain engineering of chiral chain materials.
基金Under the auspices of the Key Projects of Philosophy and Social Sciences Research,Ministry of Education of China(No.23JZD008)National Natural Science Foundation of China(No.42171193)+2 种基金Key Project of Guangdong Provincial Philosophy and Social Sciences Planning(No.GD24ES013,GD25ZX04)2025 Guangzhou Basic and Applied Basic Research Special Project(No.2025A04J7127)Fundamental Research Funds for the Central Universities,Sun Yat-sen University(No.24wkjc11)。
文摘The shift toward specialized and large-scale agricultural production has spurred the emergence of agricultural clusters as key forces of rural vitalization and sustainable development.This paper explored the formation and evolution of Meizhou pomelo industry cluster in China,focusing on its role in restructuring rural socio-economic systems and integrating the whole value chains.Based on a case study employing qualitative methods such as in-depth interviews and participatory observation,the agricultural cluster evolution of Meizhou pomelo was categorized into three key phases of initial decentralization,self-organized scaling,and reorganized clustering.Geographical proximity and industrial agglomeration constitute the physical foundation,while vertical/horizontal linkages,technologic-al innovation,and policy support enhance competitiveness.Special mechanisms emerge through localized social networks,farmer co-operatives’activation,and cross-regional market expansion.The cluster’s impact is manifested in the shift from extensive to standard-ized and modernized production,diversified and flexible livelihood of farmers,and the integration of agriculture with industry and ser-vices.The development of the whole value chain based on agricultural cluster represents a critical pathway for achieving agricultural modernization,encompassing both internal and external value chain optimization.Through quality assurance systems,product diversi-fication strategies,operational efficiency improvements,and brand enhancement,these clusters amplify product value propositions and market competitiveness.This systemic approach facilitates supply-demand coordination,enables resource synergies,and optimizes eco-nomic returns across the horizontal and vertical value chain.This paper argues that agricultural clusters serve as strategic catalysts for sustainable rural development by reconstructing local production systems,fostering innovation ecosystems,and aligning agricultural modernization.It contributes to debates on rural vitalization by demonstrating how agricultural clustering can reconfigure rural areas as hubs of ecological modernization,rather than mere urban peripheries.
基金financially supported by the Fundamental Research Funds for the Central Universities(JUSRP622014)Collaborative Innovation Center of Food Safety and Quality Control in Jiangsu Province,Jiangnan University(2022-3-2)National Key Research and Development Program of China(2022YFF1100300).
文摘Post-exercise whey protein isolate(WPI)supplement is beneficial for skeletal muscle recovery due to the stimulation of branched chain amino acids(BCAAs).This implies us that intake slow digestion rate of protein to sustain BCAAs releasing rate may facilitate muscle protein synthesis.To examine this hypothesis,we conducted a series of protein supplements including modified slow-digesting whey(SDW),whey,hydrolyzed whey and casein,orally to mice undergoing endurance running.Our results showed that the SDW gavage constant supplied BCAAs in the serum of mice within 6 h and significantly enhanced(P<0.01)endurance exercise capacity,compared to other groups.In addition,the SDW supplementation increased the crosssectional area of mice gastrocnemius fibers,as well as their muscle and liver glycogen content.It also increased the testosterone/cortisol ratio in serum and interleukin-6(IL-6)levels in muscle,while it decreased the tumor necrosis factor-alpha(TNF-α)levels and oxidative stress in muscle.Moreover,it may activate mechanistic target of rapamycin signaling by upregulating mRNA(bcat-1 and pgc-1α)expression.Thus,our findings illustrate that prolonged BCAAs supply duration promotes mice endurance running capacity and skeletal muscle growth,contributing to the advancement of sports nutrition practices.
文摘The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that double- stranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methy- lation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.
基金supported by the National Natural Science Foundation of China(Nos.31571511 and 31871500)
文摘DNA double-stranded break(DSB)is one of the most catastrophic damages of genotoxic insult.Inappropriate repair of DNA DSBs results in the loss of genetic information,mutation,and the generation of harmful genomic rearrangements,which predisposes an organism to immunodeficiency,neurological damage,and cancer.The tumor repressor p53 plays a key role in DNA damage response,and has been found to be mutated in 50%of human cancer.p53,p63,and p73 are three members of the p53 gene family.Recent discoveries have shown that human p53 gene encodes at least 12 isoforms.Different p53 members and isoforms play various roles in orchestrating DNA damage response to maintain genomic integrity.This review briefly explores the functions of p53 and its isoforms in DNA DSB repair.
基金financially supported by the National Natural Science Foundation of China(Nos.21574054,21722403,and 21420102007)
文摘We reported a type of strong and highly directional non-covalent interactions based on the dimerization of single-stranded helix to double-stranded helix that can achieve supramolecular polymerization, giving rise to the formation of linear supramolecular polymers.
文摘In our previous study, complete single DNA strands which were obtained from nuclei, chloroplasts and plant mitochondria obeyed Chargaff’s second parity rule, although those which were obtained from animal mitochondria deviated from the rule. On the other hand, plant mitochondria obeyed another different rule after their classification. Complete single DNA strand sequences obtained from chloroplasts, plant mitochondria, and animal mitochondria, were divided into the coding and non-coding regions. The non-coding region, which was the complementary coding region on the reverse strand, was incorporated as a coding region in the forward strand. When the nucleotide contents of the coding region or non-coding regions were plotted against the composition of the four nucleotides in the complete single DNA strand, it was determined that chloroplast and plant mitochondrial DNA obeyed Chargaff’s second parity rule in both the coding and non-coding regions. However, animal mitochondrial DNA deviated from this rule. In chloroplast and plant mitochondrial DNA, which obey Chargaff’s second parity rule, the lines of regression for G (purine) and C (pyrimidine) intersected with regression lines for A (purine) and T (pyrimidines), respectively, at around 0.250 in all cases. On the other hand, in animal mitochondrial DNA, which deviates from Chargaff’s second parity rule, only regression lines due to the content of homonucleotides or their analogs in the coding or non-coding region against those in the complete single DNA strand intersected at around 0.250 at the horizontal axis. Conversely, the intersection of the two lines of regression (G and A or C and T) against the contents of heteronucleotides or their analogs shifted from 0.25 in both coding and non-coding regions. Nucleotide alternations in chloroplasts and plant mitochondria are strictly regulated, not only by the proportion of homonucleotides and their analogs, but also by the heteronucleotides and their analogs. They are strictly regulated in animal mitochondria only by the content of homonucleotides and their analogs.
基金The authors thank Alexandra Surcel and Carey L Hendrix Lord for helpful comments on this manuscript.The work in our laboratory is supported by grants from the National Science Foundation(IBN-0077832,MCB-9896340,MCB-0092075)the National Institutes of Health(R0 1 GM63871)+3 种基金the US Department of Agriculture(2001-35301-10570 and 2003-35301-13313)Wuxing L was partially supported by the Intercollege Graduate Degree Program in Plant PhysiologyHong M gratefully acknowledges the support of the John Simon Guggenheim Foundationthe National Institutes of Health(F33 GM72245-1).
文摘Meiotic prophase I is a long and complex phase. Homologous recombination is an important process that occurs between homologous chromosomes during meiotic prophase I. Formation of chiasmata, which hold homologous chromosomes together until the metaphase I to anaphase I transition, is critical for proper chromosome segregation. Recent studies have suggested that the SPO 11 proteins have conserved functions in a number of organisms in generating sites of double-stranded DNA breaks （DSBs） that are thought to be the starting points of homologous recombination. Processing of these sites of DSBs requires the function of RecA homologs, such as RAD5 1, DMC 1, and others, as suggested by mutant studies; thus the failure to repair these meiotic DSBs results in abnormal chromosomal alternations, leading to disrupted meiosis. Recent discoveries on the functions of these RecA homologs have improved the understanding of the mechanisms underlying meiotic homologous recombination.
基金supported by the National Natural Science Foundation of China(11272193 and 10872121)the Shanghai Leading Academic Discipline Project(S30106)
文摘In microcantilever-based label-free biodetection technologies, deflection changes induced by adsorptions of double-stranded DNA （dsDNA） molecules on Au-layer surface are greatly affected by the mechanical, thermal and electrical properties of DNA biofilm. In this paper, the elastic properties of dsDNA biofilm are studied. First, the Parsegian＇s empirical potential based on a mesoscopic liq- uid crystal theory is employed to describe the interaction energy among coarse-grained DNA cylinders. Then, con- sidering a Gaussian distribution of DNA interaxial distance, the thought experiment method is used to derive an analyti- cal expression for Young＇s modulus of DNA biofilm with a stochastic packing pattern for the first time. Results show that Young＇s modulus of DNA biofilm is on the order of 10 MPa. These findings could provide a simple and effective method to evaluate the mechanical properties of soft biofilm on snbstrate.
基金Project supported by the National Natural Science Foundation of China (Grant No.11974366)the Fundamental Research Funds for the Central Universities+2 种基金Chinathe Supercomputer Center of the Chinese Academy of Sciencesthe Shanghai Supercomputer Center of China。
文摘The adsorption dynamics of double-stranded DNA(dsDNA)molecules on a graphene oxide(GO)surface are important for applications of DNA/GO functional structures in biosensors,biomedicine and materials science.In this work,molecular dynamics simulations were used to examine the adsorption of different length dsDNA molecules(from 4 bp to24 bp)on the GO surface.The dsDNA molecules could be adsorbed on the GO surface through the terminal bases and stand on the GO surface.For short dsDNA(4 bp)molecules,the double-helix structure was partially or totally broken and the adsorption dynamics was affected by the structural fluctuation of short dsDNA and the distribution of the oxidized groups on the GO surface.For long dsDNA molecules(from 8 bp to 24 bp)adsorption is stable.By nonlinear fitting of the contact angle between the axis of the dsDNA molecule and the GO surface,we found that a dsDNA molecule adsorbed on a GO surface has the chance of orienting parallel to the GO surface if the length of the dsDNA molecule is longer than 54 bp.We attributed this behavior to the flexibility of dsDNA molecules.With increasing length,the flexibility of dsDNA molecules also increases,and this increasing flexibility gives an adsorbed dsDNA molecule more chance of reaching the GO surface with the free terminal.This work provides a whole picture of adsorption of dsDNA molecules on the GO surface and should be of benefit for the design of DNA/GO based biosensors.
基金Supported by the National Natural Science Foundation of China (61205184)the Department of Education of Zhejiang Province (Y201122207)+1 种基金Open Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (YR2012013)the Young Researchers Foundation of Zhejiang Provincial Top Key Academic Discipline of Applied Chemistry and Eco-Dyeing & Finishing Engineering (ZYG2012003)
文摘A new coordination compound, [（CuI）（Btd）]n （1, Btd = 2,1,3-benzothiadiazole）, was obtained at room temperature by the reaction of 2,1,3-benzothiadiazole with CuI and KI saturated aqueous solution. It was characterized by elemental analysis, IR spectroscopy, single-crystal X-ray diffraction analysis and photoluminescence. The complex crystallizes in the triclinic Pi space group, with a = 4.1620（6）, b = 10.4590（15）, c = 10.5052（15） A, a = 69.310（2）, β = 83.608（2）, γ = 78.873（2）°, V = 419.30（10） A3, Z = 2, C6H4N2SCuI, Mr = 326.61, Dc = 2.587 g/cm^3, F（000） = 304 and/^（MoKa） = 6.464 mm-1. The final R = 0.0418 and wR = 0.0936 for 1451 observed reflections with 1 〉 2σ（I） and R = 0.0422 and wR = 0.0939 for all data. In the complex, the Cu atoms are coordinated by one nitrogen atom and three iodine atoms to form a double-stranded stair, and such stairs are further linked to build a 2D framework via C-H…I interactions.
文摘Rhizoctonia solani is a soil-borne pathogenic fungus with several distinct isolates that have been classified based on their anastomosis groups （AG＇s）. Many isolates of these fungi contain double-stranded viral RNA （dsRNA） that are cytoplasmic and viral in origin. Research in our laboratory has studied the epidemiology and molecular biology of viral RNA in R. solani, making it a useful biological model in the development of protocols for the rapid identification of biological agents. In the present study the dsRNA from the isolate EGR-4 which is characteristically large at 3.301 Kb was purified. Attempts to clone middle （M）-size dsRNA fragments from R, solani have been very difficult primarily due to artifacts that co-purify including large （L）-size dsRNA in the fungus. Various MgC12 concentrations were tested to optimize full length dsRNA PCR product. Magnesium is required for DNA polymerase, and EGR-4 requires a specific concentration; thus, several MgC1z concentrations were tested. The dsRNA was analyzed by gel electrophoresis. The gel-purified, nuclease-treated dsRNA was reverse transcribed into cDNA and ligated into the p-jet cloning vector and transformed using E. coli. All such clones were sequenced and forward and reverse primers were generated using BLAST sequence via Biosearch Technology. The plasmids were purified from transformed cultures and amplified using real-time PCR （RTqPCR） with the primers （reverse CCACCGGAAGAGGGAAATCC, forward AGCGCTGACCTTGCTATCGA ATC） and probe （5＇ Fam-AGTGCCGATCAGCCCTCCACCG-BHQ 1 3＇）. The ideal primer/probe concentration was determined through optimization by comparing the lowest threshold concentration （Ct） values using the plasmid cDNA as a template.
文摘The concept of Supply Chain 4.0 represents a transformative phase in supply chain management through advanced digital technologies like IoT, AI, blockchain, and cyber-physical systems. While these innovations deliver operational improvements, the heightened interconnectivity introduces significant cybersecurity challenges, particularly within military logistics, where mission-critical operations and life-safety concerns are paramount. This paper examines these unique cybersecurity requirements, focusing on advanced persistent threats, supply chain poisoning, and data breaches that could compromise sensitive operations. The study proposes a hybrid cybersecurity framework tailored to military logistics, integrating resilience, redundancy, and cross-jurisdictional security measures. Real-world applicability is validated through simulations, offering strategies for securing supply chains while balancing security, efficiency, and flexibility.
